Translate this page into:
Antimicrobial resistance and molecular characterization of uropathogenic Enterobacterales in community-acquired urinary tract infections
*Corresponding author: Parakriti Gupta, Department of Microbiology, Government Medical College and Hospital, Chandigarh, India. parakritii@gmail.com
-
Received: ,
Accepted: ,
How to cite this article: Gupta V, Singhal L, Singh C, Kour I, Gupta P. Antimicrobial resistance and molecular characterization of uropathogenic Enterobacterales in community-acquired urinary tract infections. J Lab Physicians. 2025;17:356-62. doi: 10.25259/JLP_230_2024
Abstract
Objectives:
Despite advances in diagnosis and management, urinary tract infection (UTI) remains one of the substantial causes of morbidity and mortality, owing to varied etiological agents and antimicrobial resistance. The present study was conducted to establish etiological agents implicated in community-acquired UTI, along with genotypic characterization of Enterobacterales.
Materials and Methods:
We performed phenotypic and genotypic characterization of resistance using disc diffusion, singleplex, and multiplex polymerase chain reaction (PCR).
Statistical analysis:
Descriptive analysis was performed using Microsoft Excel and interpreted as percentages.
Results:
A total of 250 isolates were included in the study, and the mean age of patients was 34.6 years. The most common etiological agent isolated was Escherichia coli (63%), followed by Klebsiella pneumoniae (12%). Susceptibility pattern revealed maximum susceptibility of Enterobacterales to fosfomycin, followed by piperacillintazobactam. Multidrug resistance (MDR) was noted among 81.2% of the isolates (76.8% Enterobacterales), and 5% of these isolates were resistant to all except colistin. Genotypic characterization revealed the presence of blaTEM in 54% of the isolates, followed by blaCTX-M1. Carbapenemase-encoding enzymes, namely blaIMP, blaNDM, blaVIM, and blaKPC, were noted in 1.3%, 1.3%, 2%, and 2%, respectively. Additionally, 5.6% of phenotypically resistant isolates did not harbor any tested resistance-encoding genes, whereas 6.1% of the pan-susceptible isolates harbored blaTEM, blaSHV, and blaCTX-M1 genes.
Conclusions:
The present study revealed a high prevalence of resistance to commonly used beta-lactams and less commonly recommended carbapenems. The findings of the present study highlight the need for judicious use of antimicrobials in the community, the need for periodic surveillance, and raising awareness for compliance and hand hygiene, owing to inter- and intra-genic transfer potential of resistance determinants.
Keywords
Acinetobacter
Genotypic
Klebsiella pneumonia
Multidrug resistance
Urinary tract infections
INTRODUCTION
Urinary tract infections (UTIs) are one of the most common infections worldwide, affecting both community and hospitalized patients. UTI accounts for the fifth most common infection in healthcare settings, with ~9.5% prevalence among inpatients and ~7 million patient visits to the outpatient department (OPD).[1,2] Despite advancements in diagnostics and management strategies, UTI remains one of the substantial causes of morbidity and mortality, which might be attributed to a wide plethora of etiological agents and high antimicrobial resistance. Emerging antimicrobial resistance to both oral and parenteral antibiotics has posed a colossal challenge in the management of UTIs. The same has been associated with the dissemination of strains yielding extended-spectrum β-lactamases (ESBLs), oxa-like beta-lactamases, AmpC, metallo-beta-lactamases (MBL), and carbapenemases. ESBLs and AmpC confer substantial mechanisms that create resistance to commonly used β-lactams such as penicillins, cephalosporins, and cephamycins.[3] However, resistance to second-line drugs such as carbapenems has also emerged and escalated lately, as a consequence of MBL-encoding genes.[4] Owing to the indiscriminate usage of antimicrobials and constantly increasing resistance, the Infectious Disease Society of America has recommended periodic surveillance at the local, national, and global levels.[5] Moreover, the available literature is focused mainly on the data available from nosocomial UTI, and there is still a paucity of comprehensive data pertaining to trends in outpatients. The lack of data is a major roadblock in policy-making and antimicrobial stewardship programs. The present study was conducted to establish the etiological agents implicated in community-acquired UTI, along with phenotypic and genotypic characterization for multidrug-resistant (MDR) isolates.
MATERIALS AND METHODS
This was a prospective cross-sectional study conducted over 6 months at our tertiary care center in North India. Clean catch, midstream urine samples of patients suffering from uncomplicated UTI, presenting to OPD, were included. We have focused our study on community-acquired UTI; we did not include samples from admitted patients. Samples were subjected to microscopy of a wet mount prepared from the uncentrifuged urine, followed by simultaneous culture on cysteine lactose electrolyte-deficient agar. The cultures were examined for any microbial growth after overnight incubation at 37°C aerobically and identified using conventional biochemicals and Gram stain, as per the standard microbiological procedures. Antimicrobial susceptibility was determined using the Kirby-Bauer method and interpreted according to the M100 Clinical and Laboratory Standard Institute (CLSI) 2023 guidelines. Vancomycin screen agar was used for susceptibility testing of Staphylococcus for vancomycin, and a cefoxitin disc was used to determine susceptibility of Staphylococcus for methicillin. MDR was defined as resistance to three or more classes of antimicrobials.
We also performed phenotypic characterization of ESBL, AmpC, and carbapenem resistance. Detection of ESBLs was done using the double disc synergy test, and AmpC detection was screened using a 30 μg disk of cefoxitin. Carbapenem resistance was detected using disc diffusion, following CLSI cut-off values (imipenem).[6] For genotypic characterization, PCR was performed targeting genes for ESBLs (blaTEM, blaSHV, blaOXA, blaCTXM-1, and blaCTXM-9) and carbapenemases (blaNDM, blaKPC, blaVIM, and blaIMP) [Table 1]. Multiplex PCR was used for all genes,[7] except singleplex PCR for blaNDM.[8]
| PCR name | β-lactamase targeted | Primers | Amplicon (bp) |
|---|---|---|---|
| Multiplex I TEM, SHV, and OXA-1 | TEM1 and TEM2 | F: CATTTCCGTGTCGCCCTTATTC R: CGTTCATCCATAGTTGCCTGAC |
800 |
| SHV | F: AGCCGCTTGAGCAATTAAAC R: ATCCCGCAGATAAATCACCAC |
713 | |
| OXA1, 4, and 30 | F: GGCACCAGATTCAACTTTCAAG R: GACCCCAAGTTTCCTGTAAGTG |
564 | |
| Multiplex II CTX-M1 and 9 | Variants of the CTX-M group 1, M3, and 15 | F: TTAGGAARTGTGCCGCTGYA R: CGATATCGTTGGTGGTRCCCAT |
688 |
| Variants of CTX-M group 9 and CTX-M14 | F: TCAAGCCTGCCGATCTGGT R: TGATTCTCGCCGCTGAAG |
561 | |
| Multiplex IV Metallo-beta-lactamases and carbapenemas-es | IMP | F: TTGACACTCCATTTACDG R: GATYGAGAATTAAGCCACYCT |
139 |
| VIM | F: GATGGTGTTTGGTCGCATA R: CGAATGCGCAGCACCAG |
390 | |
| KPC | F: CATTCAAGGGCTTTCTTGCTGC R: ACGACGGCATAGTCATTTGC |
538 | |
| Singleplex | NDM-1 | F: ACCGCCTGGACCGATGACCA R: GCCAAAGTTGGGCGCGGTTG |
264 |
PCR: Polymerase chain reaction, bp: Base pair
RESULTS
A total of 250 isolates from patients visiting the OPD were included in the study. The mean age was noted to be 34.6 years, with a male: female ratio of 0.47:1. Of these 250 isolates, the most common etiological agent isolated was Escherichia coli (63%), followed by Klebsiella pneumoniae (12%) and Enterococcus faecalis (8%). Other less common agents included Staphylococcus aureus (6%), Acinetobacter calcoaceticus–baumannii complex (Acinetobacter cbc) (4%), Pseudomonas aeruginosa (3%), Citrobacter koseri (1.6%), and Proteus vulgaris (2%) [Figure 1]. The majority of the organisms were members of Enterobacterales (78.4%; n = 196). Antimicrobial susceptibility pattern revealed that members of Enterobacterales were more sensitive to fosfomycin (89.3%), followed by piperacilin-tazobactam (83.2%) and nitrofurantoin (79.1%). The least sensitivity was noted for ciprofloxacin (18.4%), followed by third-generation cephalosporins (cefepime [21.4%], cefotaxime [25.0%], and ceftazidime [26.0%]) [Figure 2]. Maximum susceptibility for E. coli was noted for fosfomycin, trailed by nitrofurantoin and piperacillin-tazobactam, whereas the least susceptibility was noted for ciprofloxacin, followed by cefepime and cefotaxime/ceftazidime. On the contrary, isolates of K. pneumoniae exhibited the least susceptibility to nitrofurantoin, followed by amoxicillin-clavulanic acid; with maximum susceptibility to fosfomycin, followed by imipenem. For P. vulgaris and C. koseri, maximum susceptibility was noted for fosfomycin, piperacillin-tazobactam, imipenem, and amikacin, with the least susceptibility to cefotaxime, cefepime, and ciprofloxacin. For Acinetobacter cbc, 100% susceptibility was noted for tobramycin, followed by ampicillin-whereas the least susceptibility was noted for cefotaxime and nitrofurantoin. P. aeruginosa exhibited maximum susceptibility for aztreonam, amikacin, and gentamicin, whereas the least susceptibility was to ceftazidime.


Among the Gram-positive organisms, S. aureus exhibited 100% susceptibility to linezolid and nitrofurantoin, trailed by tetracycline and doxycycline. The least susceptibility was noted for penicillin, with all the isolates being resistant to penicillin, followed by ciprofloxacin and methicillin. Of all the isolates, 46.7% were noted to be methicillin resistant. E. faecalis showed maximum susceptibility to fosfomycin and linezolid, followed by vancomycin (10% vancomycin resistance), with the least susceptibility to ciprofloxacin and tetracycline, followed by erythromycin and high-level gentamicin.
MDR was noted among 81.2% of the isolates, of which 76.8% were members of Enterobacterales. Of these 81.2% MDR isolates, 5% (n = 10) isolates were noted to be extensively drug resistant (XDR), being resistant to all antibiotics except colistin. All these XDR isolates (susceptible only to colistin) were noted to be Acinetobacter cbc (n = 7) and K. pneumoniae (n = 3).
Of Enterobacterales (n = 196), 59% isolates were noted to be ESBL-producers, 18% AmpC producers, and 6% isolates exhibited carbapenem resistance, whereas both ESBL and AmpC were noted in 4.08% of the isolates. Genotypic characterization revealed the presence of blaTEM in 54% of the isolates, followed by blaCTX-M1 in 35%, blaCTX-M9 in 26%, blaSHV in 25%, and blaOXA in 19% of the isolates. Carbapenemase-encoding genes, namely blaIMP, blaNDM, blaVIM, and blaKPC, were noted in 1.3%, 1.3%, 2%, and 2%, respectively [Figure 3]. Both carbapenemase and ESBL genes were encoded in four isolates (one isolate harboring both blaKPC and blaTEM; one with blaVIM and blaSHV; one with blaNDM and blaCTXM-1; and one with blaNDM, blaTEM, blaCTXM-1, blaCTXM-9, and blaOXA). Furthermore, four isolates harboring carbapenemase-encoding genes (two with blaNDM, one each with blaVIM and blaIMP-1) did not express carbapenem resistance phenotypically by the methods tested in the study, while three carbapenem-resistant isolates did not harbor the tested genes. Similar findings were noted for ESBL genes also, wherein three isolates with phenotypic expression of ESBL did not harbor any of the tested ESBL genes, whereas 51 isolates were noted to harbor the ESBL genes, but phenotypic tests were negative for ESBL production. A total of 5.6% of phenotypically resistant isolates did not harbor any resistance-encoding genes, whereas 6.1% of the pan-susceptible isolates harbored blaTEM, blaSHV, and blaCTX-M1 genes. These pan-susceptible isolates harboring the resistance-encoding genes were noted to be E. coil. Seven isolates harbored both blaTEM and blaSHV, three isolates harbored merely blaTEM and two isolates harbored only the blaCTX-M1 gene.

DISCUSSION
The present study was conducted to determine the antimicrobial resistance among uropathogens isolated from OPD patients at our center. UTI accounts for a substantial burden of both hospital-acquired and community-acquired infections. Although studies pertaining to the burden of hospital-acquired infections are available, literature for antimicrobial susceptibility of community-acquired UTIs is scant. UTI was noted to be more common in females, which is in congruence with the previous literature.[9] We found 81.2% MDR and 5% XDR isolates, with the least susceptibility to ciprofloxacin and cephalosporins. The higher rates of antimicrobial resistance noted in our study are in concordance with the previous studies. Recently, a global prevalence study has reported the highest resistance to fluoroquinolones, followed by cephalosporins,[10] which is in congruence with findings of our study. The study reported higher resistance of 58.8% for cotrimoxazole, 55% for ampicillin with betalactamase inhibitor, 54.9% resistance for ciprofloxacin, 49.4% for cefuroxime, 45.1% for ceftazidime, 42.5% for cefotaxime, 41.4% for gentamicin, 39.6% for cefepime, 39.4% for fosfomycin, 39% resistance for levofloxacin, and 37.3% for piperacillin-tazobactam. Lower level of resistance was noted for amikacin (24.9%) and imipenem (11.3%).[10] The resistance reported in our study is comparatively higher for all the antibiotics, compared to previous studies, except amoxycillin-clavulanic acid, while in the same range for cotrimoxazole. A higher level of carbapenem resistance of 17.5% was noted, which is in concordance with findings by Mohan et al. (9.3% and 12.3% in 2008 and 2012, respectively).[4] In a study conducted in Jharkhand, E. coli and Klebsiella spp. were reported as common etiological agents of UTI, with high resistance to nalidixic acid, retaining 90.8% susceptibility to imipenem, 85.4% to meropenem in E. coli.[11] Another study from Kerala reported E. coli (74.3%) and Klebsiella spp. (15.8%) as common etiological agents. All the isolates of E. coli were reported to be sensitive to amikacin, piperacillin, and imipenem, simultaneously exhibiting 100% resistance to ampicillin and cephalosporins. Susceptibility to nitrofurantoin and cefoperazone was noted to be 90% each. In their study, Klebsiella spp. exhibited 100% susceptibility to amikacin and piperacillin, with 100% resistance to ampicillin, cephalosporins, and 65% resistance to imipenem.[12] A study from Pakistan also reported E. coli and Klebsiella spp. as the common agents, with 84% isolates being resistant to all cephalosporins and exhibiting 85% resistance to cotrimoxazole, 80.2% to norfloxacin, 83.5% nalidixic acid, and 77.9% to ciprofloxacin. Lower levels of resistance to nitrofurantoin (28.4%), amikacin (36.8%), imipenem (25.9%), fosfomycin (35.3%), and colistin (21.8%) were noted.[13]
The astounding characteristic in the present study is the higher level of resistance for almost all classes of antimicrobials isolated from OPD patients. This highlights the escalating resistance in our community settings, which is higher as compared to the hospital settings of other regions. Global prevalence studies have shown higher levels of resistance in Asian countries, as compared to the rest of the world, with the highest being in the Southeast Asian region.[14] The relatively higher rates of resistance have been attributed to ecological and socioeconomic factors. However, the most significant factor remains over-the-counter availability and indiscriminate usage of antimicrobials in the veterinary as well as our health sector for minor ailments such as gastroenteritis, where oral rehydration can be put to use.[14] Besides these factors, the implementation of diagnostic and antimicrobial stewardship programs in the OPD also plays a vital role.
The common mechanism of resistance in uropathogens includes production of β-lactamases such as ESBLs and AmpC, conferring resistance to extended-spectrum penicillins, cephalosporins, and monobactams. A worldwide rise in the prevalence of ESBLs has been reported.[15-17] A study by Thaden et al. reported an increasing trend of community-acquired-ESBL in cases of UTI, more so in E. coli as compared to Klebsiella species.[18] The findings are concordant with the present study, wherein E. coli is reported to harbor more resistanceencoding genes. Besides ESBLs, the AmpC enzyme has also escalated the threat of antimicrobial resistance. AmpCs preferentially hydrolyze cephamycins and cephalosporins but are not inhibited by sulbactam, clavulanate, or tazobactam.[19] Furthermore, the presence of AmpC in addition to the ESBL enzymes poses a challenge in the diagnostic confirmation of ESBL detection. The present study divulged the presence of ESBL in 59% of isolates, AmpC in 18%, whereas both ESBL and AmpC were noted in 4.08% of the isolates. Besides the commonly used drugs, carbapenems are also being used as a last resort in the management of resistant cases of UTI.[20] With the widespread usage of carbapenems for a plethora of infections, resistance has also been reported, and the common mechanism has been ascribed to the acquisition of carbapenemases.[21,22] Increased isolation of ESBL and carbapenemase-producing E. coli poses a huge threat of treatment failure in cases of UTI, since E. coli is the most commonly isolated uropathogen. The universal carriage of E. coli in the gut further convolutes the transmission dynamics of resistance in both community-acquired and hospital-acquired UTI. Previously, ESBL-producing E. coli was isolated mainly from cases of nosocomial UTI; however, recent studies have shown the presence of ESBL-producing and carbapenemase-producing E. coli in community settings as well. In a recent study by Paul et al., 26% ESBL-producing isolates of E. coli were reported, which is lower as compared to the present study.[23] The findings of the present study are comparatively higher compared to the previous studies reported in the literature.[3,24-26] Taneja et al. have reported 36.5% uropathogens to be ESBL producers, whereas AmpC production was noted in all 53 piperacillin and piperacillin-tazobactam positive isolates tested.[3] Another study reported from the same center reported a rise in prevalence of blaNDM-1 gene from nil to 10.8% among non-fermenters and nil to 84.3% among Enterobacterales, from 2008 to 2012. Variation in blaIMP (5.2–9.5–0–2%) and blaVIM (19–52.6–15.7–29.7%) has also been reported. The authors found zero occurrence of the blaKPC gene in their study. A few isolates harboring two antibiotic resistance-encoding genes were also reported.[4] The present study divulged a lower prevalence of blaNDM (3.1%), blaIMP (1.5%), and blaVIM (2.6%), while blaKPC was also noted in 0.5% of the isolates, which is in contrast to the findings of Mohan et al.[4] blaTEM was noted to be the most common gene responsible for resistance, in contrast to previous studies, wherein blaCTX-M was reported to be the most common ESBL type.[23,27,28] We noted both the strains harboring blaNDM-1 to be resistant to all the antibiotics except fosfomycin, colistin, and amikacin (one susceptible and one intermediately susceptible). Such an MDR pattern has been reported earlier, where the authors found such strains to be susceptible merely to colistin and tigecycline.[23]
The present study revealed that 5.6% of phenotypically resistant isolates did not reveal the presence of any tested resistance encoding genes, which is less compared to 52.6% (2008) and 28.4% (2012) reported from North India.[4] An increasing trend over the years has been noted for isolates harboring resistance-encoding genes. This might be conferred by the circulation of plasmids and resistance determinants. In a study by Paul et al.[23] and Paterson and Bonomo et al.,[28] ESBLs and blaNDM-1 gene were noted to be carried in the self-transmissible plasmids.[23,28] In the present study, multiple beta-lactamase genes were noted within a single isolate, with the presence of ESBL and carbapenemase genes also within a single isolate, which might be attributed to the presence of multiple resistance determinants in a single plasmid. The presence of such multiple determinants within one isolate poses a major concern, lessening the available treatment options.[29] Furthermore, 6.1% of isolates harboring these genes did not exhibit phenotypic resistance. Although the isolates exhibited susceptibility, the presence of resistance-encoding genes is worrisome, owing to the tendency for horizontal gene transfer through plasmids, which confer resistance to other organisms or to future generations. The susceptibility profile in the present study divulged resistance to cephalosporins and ciprofloxacin, in congruence with reported literature.[23,30] The reduced susceptibility to these agents is alarming, as these are commonly employed agents for community-acquired cases of UTI. This escalating resistance among community-acquired pathogens has been ascribed to indiscriminate, over-the-counter usage of antimicrobials and less access to health-care facilities, which further leads to self-treatment with inappropriate or leftover antimicrobials, convoluting the growing problem of AMR.
CONCLUSIONS
The present study revealed a higher prevalence of resistance to commonly used beta-lactams and less commonly recommended carbapenems in our isolates, highlighting the need for judicious usage of antimicrobials in the community and adherence to the stewardship guidelines. Higher levels of carbapenem resistance from patients presenting to OPD with UTI demand periodic continuous surveillance, raising awareness for compliance and hand hygiene, as these resistance-encoding genes have the potential for inter- and intra-genic transfer, further escalating the impending silent pandemic of antimicrobial resistance.
Author contributions:
VG, LG: Conceptualized and supervised the study; CM, IK: Bench work and data collection; PG: Data analysis; writing of the first draft; All authors read and approved the final manuscript.
Ethical approval:
The research/study was approved by the Institutional Review Board at GMCH, approval number GMCH/ IEC/845R/2020/450/40, dated 10th February 2021.
Declaration of patient consent:
Patient’s consent is not required as there are no patients in this study.
Conflicts of interest:
There are no conflicts of interest.
Use of artificial intelligence (AI)-assisted technology for manuscript preparation:
The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.
Financial support and sponsorship: Nil.
References
- Epidemiology of urinary tract infections: Incidence, morbidity, and economic costs. Dis Mon. 2003;49:53-70.
- [CrossRef] [PubMed] [Google Scholar]
- Urinary tract infection (catheter-associated urinary tract infection [CAUTI] and non-catheter-associated urinary tract infection [UTI]) events. 2020. United States: Centers for Disease Control and Prevention; :1-20. Available from: https://www.cdc.gov/nhsn/pdfs/pscmanual/7psccauticurrent.pdf [Last accessed on 2024 Sep 19]
- [Google Scholar]
- Occurrence of ESBL and Amp-C beta-lactamases and susceptibility to newer antimicrobial agents in complicated UTI. Indian J Med Res. 2008;127:85-8.
- [Google Scholar]
- Occurrence of blaNDM-1 and absence of blaKPC genes encoding carbapenem resistance in uropathogens from a tertiary care centre from North India. Indian J Med Res. 2015;142:336-43.
- [CrossRef] [PubMed] [Google Scholar]
- International clinical practice guidelines for the treatment of acute uncomplicated cystitis and pyelonephritis in women: A 2010 update by the infectious diseases society of America and the European society for microbiology and infectious diseases. Clin Infect Dis. 2011;52:e103-20.
- [CrossRef] [PubMed] [Google Scholar]
- CLSI guidelines. Available from: https://www.com/clsi.org [Last accessed on 2023 Aug 16]
- [Google Scholar]
- Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J Antimicrob Chemother. 2010;65:490-5.
- [CrossRef] [PubMed] [Google Scholar]
- Emergence of carbapenem-resistant Enterobacteriaceae in Austria, 2001-2010. Clin Microbiol Infect. 2011;17:E5-8.
- [CrossRef] [PubMed] [Google Scholar]
- Prevalence of bacterial urinary tract infections and associated factors among patients attending hospitals in Bushenyi district, Uganda. Int J Microbiol. 2019;2019:4246780.
- [CrossRef] [PubMed] [Google Scholar]
- Aspects of urinary tract infections and antimicrobial resistance in hospitalized urology patients in Asia: 10-Year results of the global prevalence study of infections in urology (GPIU) J Infect Chemother. 2018;24:278-83.
- [CrossRef] [PubMed] [Google Scholar]
- Antimicrobial susceptibility pattern of urine culture isolates in a tertiary care hospital of Jharkhand, India. Int J Basic Clin Pharmacol. 2017;6:1733-9.
- [CrossRef] [Google Scholar]
- A study on the bacteriological profile of urinary tract infection in adults and their antibiotic sensitivity pattern in a tertiary care hospital in central Kerala, India. Int J Res Med Sci. 2017;5:666-9.
- [CrossRef] [Google Scholar]
- Bacterial profile and antimicrobial resistance of uropathogenic Enterobacteriaceae. Urology. 2019;13:451-4.
- [CrossRef] [Google Scholar]
- Healthcare-associated urinary tract infections in hospitalized urological patients--a global perspective: Results from the GPIU studies 2003-2010. World J Urol. 2014;32:1587-94.
- [CrossRef] [PubMed] [Google Scholar]
- Prevalence of extended spectrum β-Lactamases in multidrug resistant strains of gram negative Bacilli. J Acad Indus Res. 2013;1:558-60.
- [Google Scholar]
- Antibiogram typing of gram negative isolates in different clinical samples of a tertiary hospital. Asian J Pharm Clin Res. 2013;3:153-6.
- [Google Scholar]
- The frequency of extended spectrum beta lactamase (ESBL) in Escherichia coli and Klebsiella pneumoniae: A report from Mashhad, Iran. J Med Bacteriol. 2012;1:12-9.
- [Google Scholar]
- Increasing incidence of extended-spectrum β-lactamase-producing Escherichia coli in community hospitals throughout the southeastern United States. Infect Control Hosp Epidemiol. 2016;37:49-54.
- [CrossRef] [PubMed] [Google Scholar]
- Extended-spectrum-beta-lactamase, AmpC, and carbapenemase issues. J Clin Microbiol. 2010;48:1019-25.
- [CrossRef] [PubMed] [Google Scholar]
- Bloodstream infections caused by extended-spectrum-beta-lactamase-producing Klebsiella pneumoniae: Risk factors, molecular epidemiology, and clinical outcome. Antimicrob Agents Chemother. 2006;50:498-504.
- [CrossRef] [PubMed] [Google Scholar]
- Laboratory detection and clinical implication of oxacillinase-48 like carbapenemase: The hidden threat. J Glob Infect Dis. 2016;8:41-50.
- [CrossRef] [PubMed] [Google Scholar]
- Molecular characterization of carbapenem-resistant Enterobacteriaceae at a tertiary care laboratory in Mumbai. Eur J Clin Microbiol Infect Dis. 2015;34:467-72.
- [CrossRef] [PubMed] [Google Scholar]
- Antimicrobial resistance in patients with suspected urinary tract infections in primary care in Assam, India. JAC Antimicrob Resist. 2021;3:dlab164.
- [CrossRef] [PubMed] [Google Scholar]
- Prevalence of extended spectrum beta-lactamase producing uropathogens and their antibiotic resistance profile in patients visiting a tertiary care hospital in central India: Implications on empiric therapy. Indian J Pathol Microbiol. 2014;57:407-12.
- [CrossRef] [PubMed] [Google Scholar]
- Molecular characterization of extended-spectrum β-lactamases among clinical isolates of Escherichia coli and Klebsiella pneumoniae: A multi-centric study from tertiary care hospitals in India. Indian J Med Res. 2019;149:208-15.
- [CrossRef] [PubMed] [Google Scholar]
- Increased isolation of extended-spectrum beta-lactamase-producing Escherichia coli from community-onset urinary tract infection cases in Uttarakhand, India. Cureus. 2021;13:e13837.
- [CrossRef] [Google Scholar]
- CTX-M type extended-spectrum β-lactamase in Escherichia coli isolated from extra-intestinal infections in a tertiary care hospital in South India. Indian J Med Res. 2019;149:281-4.
- [CrossRef] [PubMed] [Google Scholar]
- Extended-spectrum beta-lactamases: A clinical update. Clin Microbiol Rev. 2005;18:657-86.
- [CrossRef] [PubMed] [Google Scholar]
- High prevalence of carbapenemase, AmpC β-lactamase and aminoglycoside resistance genes in extended-spectrum β-lactamase-positive uropathogens from Northern India. J Glob Antimicrob Resist. 2020;20:197-203.
- [CrossRef] [PubMed] [Google Scholar]
- Available from: https://www.who.int/initiatives/glass [Last accessed on 2023 Aug 12]

