Translate this page into:
Molecular screening of extended-spectrum β-lactamase and carbapenemase resistance genes in hospital wastewater from Eastern Odisha: Predominance of extended-spectrum β-lactamase determinants and absence of blaNDM and blaKPC
*Corresponding author: Sunita Kabi, Department of Microbiology, IMS and SUM Hospital, Siksha ‘O’ Anusandhan, Deemed to be University, Bhubaneswar, Odisha, India. sunitakabi@soa.ac.in
-
Received: ,
Accepted: ,
How to cite this article: Das A, Kabi S, Jena L, Das BS, Sahu KK. Molecular screening of extended-spectrum β-lactamase and carbapenemase resistance genes in hospital wastewater from Eastern Odisha: Predominance of extended-spectrum β-lactamase determinants and absence of blaNDM and blaKPC. J Lab Physicians. doi: 10.25259/JLP_39_2026
Abstract
Objectives:
The objective of the study is to determine the prevalence of antibiotic-resistant bacteria and characterize major ESBL and carbapenemase resistance genes in HWW from Bhubaneswar, Odisha, India.
Materials and Methods:
Wastewater samples were collected quarterly from six tertiary-care hospitals between May 2022 and February 2023. A total of 164 bacterial isolates were recovered and identified by conventional microbiological methods. Antimicrobial susceptibility testing was performed using the Kirby–Bauer disk diffusion method. Thirty-eight multidrug-resistant isolates representing different bacterial species, hospital sites, and resistance profiles were selected for molecular analysis. Genomic DNA was extracted by the salting-out method, and polymerase chain reaction was used to detect blaTEM, blaCTX-M, blaSHV, blaOXA, blaKPC, and blaNDM genes.
Statistical Analysis:
Categorical data were summarized using frequencies and percentages.
Results:
Among the 164 isolates, Klebsiella pneumoniae (62%) was the predominant species, followed by Escherichia coli (25%), Pseudomonas aeruginosa (10%), and Enterococcus spp. (3%). High resistance rates were observed against cefuroxime (100%), piperacillin/tazobactam (99%), ofloxacin (99%), norfloxacin (98%), and nitrofurantoin (97%). Molecular analysis showed that blaTEM (34%) was the most prevalent gene, followed by blaCTX-M (26%), blaOXA (18%), and blaSHV (13%), whereas blaKPC and blaNDM were not detected.
Conclusion:
HWW in eastern Odisha harbors multidrug-resistant bacteria and ESBL-associated resistance genes, emphasizing the need for continuous environmental surveillance and improved wastewater management.
Keywords
Antibiotic resistance genes
Beta-lactamases
blaKPC
blaNDM
Carbapenemase
Enterobacteriaceae
Hospital wastewater
INTRODUCTION
Hospital wastewater (HWW) originates from various healthcare settings, including patient care areas, operating rooms, laboratories, and the disposal of pharmaceutical waste, along with wastewater produced by administrative departments, laundries, kitchens, and other sections of the hospital.[1,2] A failure to appropriately treat HWW can cause the release of antibiotic-resistant bacteria (ARB) into municipal sewage systems, rivers, and other water bodies, which can then spread into the environment and into human populations.[3]
HWW, an essential but frequently ignored factor in the transmission of antimicrobial resistance (AMR), acts as a major source and pathway for antimicrobial- resistant bacteria (ARB).[4] Hospital effluent is a key site for antimicrobial-resistant bacteria (ARB) because of the elevated concentrations of antibiotics and various pharmaceuticals, which greatly contribute to the emergence of antimicrobial-resistant pathogenic bacteria and the global spread of infections.[5,6] As a result of presenting sub-lethal concentrations of antibiotics into HWW, AMR can develop in these environments. As a result, wastewater from hospitals serves as a crucial pathway for the source of antibiotics entering the environment; it includes a variety of biological materials, including human waste that still contains metabolized antimicrobials.[7] HWW is home to numerous pathogenic microbes such as Escherichia coli, Pseudomonas aeruginosa, and Enterococcus spp., some of which are transmitted directly to patients by personnel in the healthcare field, or via contaminated medical equipment.[8] Based on information from the World Health Organization (WHO), HWW is a major global contributor to the emergence of AMR in pathogenic bacteria.[9]
Antibiotic resistance is a critical global public health issue that could become a leading cause of illnesses in the near future.[10] This danger is exacerbated by the widespread use of antibiotics in medical facilities, where a large percentage (30– 90%) of these drugs are excreted by patients and then released into the environment. The ongoing release of antibiotics into the environment, often at sub-lethal levels within HWW, has the capacity to trigger and perpetuate antibiotic resistance in bacteria.[11,12] There is an increasing interest in examining the existence of these bacteria in the environment, particularly in connection with human activities. HWW is recognized as a major source of antibiotic-resistant bacteria and acts as a connection between human communities and their environmental ecosystems.[13-15] In this environment, bacterial populations engage with each other and can obtain, modify, and share resistance genes. The transmission of these genes may occur via different mechanisms, particularly through horizontal gene transfer facilitated by plasmids.[16] Before being released into water bodies, wastewater is treated at wastewater treatment plants (WWTPs) to remove pollutants and microbes. Chlorine is frequently utilized for disinfection in accordance with WHO guidelines and local standards. Nonetheless, treatment failures can still lead to the presence of antibiotic-resistant bacteria.[17-19]
There is a rising worry about the escalating prevalence of environment-based AMR bacteria (ARB). Releasing sewage from hospitals consists of a mixture that includes the waste materials and excretions of individuals receiving treatment, along with wastewater that harbors ARB from medical settings. There are a number of reasons why sewage is regarded as a reservoir for antibiotic resistance. The reason for this is that it is crucial for horizontal gene transfer, which promotes the dissemination of resistant genes for antibiotics.[20]
Wastewater contains antibiotic residues, pollutants, and nutrients, which serve as selective pressures that encourage microorganisms to develop resistance. These mutations and horizontal gene transfers may result in the dissemination of resistance.[21] Beta-lactam defenses against many different infections can be compromised by extended-spectrum β-lactamase (ESBL) enzymes, which destroy virtually all beta-lactams. With the emergence of blaCTX-M as the most common ESBL, it is responsible for the development of resistance to antibiotics such as penicillins and oxyimino- cephalosporins in combination with blaSHV and blaTEM.[22] In the past, carbapenems and cephamycins were preferred for the treatment of ESBL bacteria. However, in light of the rising prevalence of bacteria such as blaOXA, blaKPC, and the newly identified blaNDM, these drugs are no longer effective.
A significant and escalating issue for human health pertains to the rise and swift dissemination of antibiotic resistance.[23] Antibiotics with beta-lactam residues are commonly prescribed around the world as both humans and animals use them to treat infections.[24] A major concern regarding these medications is the quick development of beta-lactamases, particularly among Gram-negative bacteria (GNB); this creates every fresh medication to lose its effectiveness in a brief period.[25] In the beta-lactam category, carbapenem antibiotics are considered the most reliable final option for treating infections caused by bacteria that produce ESBLs.[26] On a global scale, carbapenem resistance represents a significant public health issue. This is due to the production of carbapenemase. Penicillins, cephalosporins, and carbapenems can all be broken down by carbapenemases, which limits the choice of antibiotics.[27] Research indicates that serious infections caused by carbapenem-resistant Enterobacteriaceae are associated with higher mortality rates among hospitalized patients.[28,29] There have been several types of carbapenemases developed, with the most commonly identified enzymes being Ambler class A beta- lactamases (such as KPC), class B beta-lactamases/metallo- beta-lactamases (such as NDM and IMP), and class D oxacillinases (such as OXA-48 and OXA-58).[30] Genes that encode carbapenemases are typically located on mobile genetic elements, which are capable of being transferred from one species of bacterium to another.[31] In particular, organisms within the Enterobacteriaceae family and Acinetobacter typically act as significant carriers for the spread of beta-lactamase genes within naturally occurring bacterial ecosystems.[32,33]
Although HWW has increasingly been recognized as an important reservoir of AMR genes (ARGs), most studies from India have been conducted in selected metropolitan regions, and data from eastern India, particularly Odisha, remain scarce. Furthermore, information regarding the distribution of clinically important ESBL and carbapenemase genes in HWW from Odisha is limited. The absence of such regional surveillance data restricts our understanding of the environmental dissemination of AMR and hinders the development of targeted mitigation strategies. Therefore, this study aimed to investigate the prevalence of ARB and characterize major ESBL and carbapenemase genes (blaTEM, blaCTX-M, blaSHV, blaOXA, blaKPC, and blaNDM) in wastewater collected from six tertiary-care hospitals in Bhubaneswar, Odisha. The findings provide baseline evidence on the environmental burden of resistance genes in eastern India and contribute to ongoing efforts to strengthen AMR surveillance using a one health approach.
MATERIALS AND METHODS
Study setting and sampling sites
A total of six tertiary-care hospitals in Bhubaneswar, Odisha, were included in the study. Wastewater samples were collected quarterly between May 2022 and February 2023, resulting in four sampling rounds at each hospital. The surface wastewater samples were taken from the open flowing areas across the hospital grounds, while additional samples were collected from different discharge points within the hospitals. These samples are referred to as wastewater from Capital Hospital (site 1), Sum Hospital (site 2), Vivekananda Hospital (site 3), Manipal Hospital (site 4), Kalinga Hospital (site 5), and Utkal Hospital (site 6).
Sample collection
Samples were collected in 500 mL borosil glass bottles. Composite wastewater samples were generated from grab samples collected at 30-min intervals between 8:00 am and 11:00 am from designated discharge points, including septic tanks, manholes, and outlet channels. The selected hospitals represented different wastewater disposal systems, including direct discharge pipelines and post-treatment septic tank- based systems. All samples were transported to the laboratory under refrigerated conditions (4°C) and processed within 24 h of collection.
Bacterial isolation and identification
A serial dilution of the bacterial suspensions was carried out to reduce the bacterial colonies to isolate pure colonies. Utilizing the pour plate method, each diluted sample was placed inoculate nutrient agar and incubated at 37°C for 24 h. The colony count was recorded, and individual colonies from each nutrient plate were transferred separately onto MacConkey Agar plates, followed by an overnight incubation at 37°C for a duration of 24 h. The plates were labeled with the name of the wastewater treatment facility, the sampling site, the date, and the sample number. In addition, the bacterial isolates were classified based on their morphological traits and biochemical assessments and identified following the criteria outlined in Bergey’s Manual of Determinative Bacteriology.[34]
Antimicrobial susceptibility test
After isolating and identifying the bacteria from each collected sample, to evaluate the isolates’ antimicrobial susceptibility profiles, the standard Kirby–Bauer disk diffusion technique was used.[35] To create bacterial inoculums, freshly cultured bacteria were suspended in 4–5 mL of normal saline, ensuring that the cloudiness of the solution was equivalent to that of a 0.5 McFarland standard. Using a cotton swab, this suspension was spread uniformly across Müller–Hinton agar to produce continuous growth. All antibiotics were sourced from HiMedia Pvt. Ltd., which includes amikacin (AK) – 30 mcg; ampicillin (AMP) – 30 mcg; chloramphenicol (C) – 30 mcg; colistin – 10 mcg; ceftazidime (CAZ) – 30 mcg; CEFOPERAZONE/sulbactam – 50 mcg; ciprofloxacin (CIP) – 5 mcg; cefepime/tazobactam (CPT) – 30 mcg; co-trimoxazole (COT) – 25 mcg; ceftriaxone (CTR) – 30 mcg; cefotaxime – 30 mcg; cefuroxime (CXM) – 30 mcg; gentamicin (HLG) – 120 mcg; imipenem/cilastatin – 10 mcg; minocycline – 30 mcg; meropenem (MRP) – 10 mcg; nitrofurantoin (NIT) – 300 mcg; norfloxacin (NX) – 10 mcg; ofloxacin (OF) – 5 mcg; polymyxin B (PB) – 300 units; and piperacillin/tazobactam (PIT) – 100 mcg. During the susceptibility testing, the plates were kept at 37°C for 18– 24 h. Upon completion of the incubation, the diameters of the inhibition zones for each antibiotic were measured in millimeters and evaluated against the standards established by the Clinical Laboratory Standards Institute (CLSI) guidelines.[36] Isolates were categorized into three categories according to measurement of inhibition zones: Resistant (R), intermediate (I), and sensitive (S).
Extraction of genomic DNA
Genomic DNA was obtained through the salting-out method, which depends on fresh overnight liquid cultures to facilitate DNA extraction. Of the 164 bacterial isolates recovered from HWW, 38 isolates were selected for genotypic analysis using a purposive stratified sampling approach. The selection was designed to ensure representation of different hospital sites, bacterial species, and AMR profiles. Isolates were not selected randomly. Instead, priority was given to isolates exhibiting resistance to multiple antibiotics, particularly β-lactam agents, because these isolates were considered more likely to harbor ESBL- and carbapenemase-associated resistance genes.
The selected isolates included representatives from all six hospital sampling sites and the major bacterial species identified in this study. “High resistance” was defined as resistance to multiple antimicrobial agents belonging to different antibiotic classes based on antimicrobial susceptibility testing results. “High levels of antibiotic resistance” can be defined more precisely, for example:
Resistant to ≥3 antibiotic classes (preferred definition of multidrug resistance) or
Resistant to ≥5 tested antibiotics.
Selection of isolates for genotyping
The rationale for selecting 38 isolates was to obtain a representative subset for molecular screening while maintaining feasibility within available laboratory resources. A total of 164 bacterial isolates were recovered from HWW samples. Among these, 38 isolates were selected for molecular characterization using a purposive stratified sampling strategy. Selection was based on three criteria: (i) Representation of all six hospital sampling sites, (ii) inclusion of different bacterial species identified during the study, and (iii) AMR profile. Priority was given to isolates exhibiting multidrug resistance, particularly resistance to β-lactam antibiotics, as these were considered more likely to carry ESBL- and carbapenemase-associated resistance genes. The selected subset consisted of Klebsiella pneumoniae, E. coli, P. aeruginosa, and Enterococcus isolates distributed across the different HWW sites [Table 1].
| Different hospital sites | No. of probable isolates |
|---|---|
| Capital hospital (site 1) | Klebsiella pneumoniae - 3 |
| Escherichia coli - 3 | |
| Pseudomonas aeruginosa - 2 | |
| Enterococcus - 1 | |
| Sum hospital (site 2) | Klebsiella pneumoniae - 4 |
| Escherichia coli - 2 | |
| Pseudomonas aeruginosa - 0 | |
| Enterococcus - 0 | |
| Vivekananda hospital (site 3) | Klebsiella pneumoniae - 2 |
| Escherichia coli - 3 | |
| Pseudomonas aeruginosa - 2 | |
| Enterococcus - 0 | |
| Manipal hospital (site 4) | Klebsiella pneumoniae - 2 |
| Escherichia coli - 2 | |
| Pseudomonas aeruginosa - 2 | |
| Enterococcus - 1 | |
| Kalinga hospital (site 5) | Klebsiella pneumoniae - 2 |
| Escherichia coli - 1 | |
| Pseudomonas aeruginosa - 1 | |
| Enterococcus - 1 | |
| Utkal hospital (site 6) | Klebsiella pneumoniae - 2 |
| Escherichia coli - 1 | |
| Pseudomonas aeruginosa - 1 | |
| Enterococcus - 0 |
To form a cell pellet, 2 mL of liquid culture was centrifuged for 1 min at maximum speed. A concentrated pellet was obtained after repeating this procedure 2–3 times. Following the removal of the supernatant, the pellet was carefully resuspended in 600 µL of lysis buffer with a gentle pipetting technique. After mixing, the mixture was incubated for 1 h at 37°C. To begin the precipitation process, 600 µL of 5M NaCl was added to the mixture. Before centrifuging at 10,000 revolutions/min for 10 min, this was vortexed gently for 15 s. A new tube was used to carefully transfer the upper aqueous layer after this procedure. After the white protein layer was removed completely, the process was repeated. The separated aqueous layer was mixed softly with 2.5–3 volumes of ice-cold absolute ethanol before precipitating the DNA. This mixture was then placed in the refrigerator at −20°C for 30 min, after which it underwent spin at the highest speed for 15 min at 4°C using centrifugation. The DNA pellet was rinsed with 1 mL of cold 70% ethanol and then centrifuged for 2 min under the same conditions after the supernatant was removed. After removing the supernatant, the DNA pellet was inverted onto a paper towel at room temperature to air-dry. In the end, 600 µL of TE buffer was used to resuspend the DNA after it had been dried.
Genes associated with antibiotic resistance can be identified by PCR
A total of six β-lactam resistance genes were examined in the chosen isolates, specifically: blaSHV, blaTEM, blaCTX-M, blaNDM, blaOXA, and blaKPC. The primer sequences and the corresponding sizes of the amplicons are presented in Table 2. Each polymerase chain reaction (PCR) reaction included 2.5 µL of PCR buffer, 1–2 µL of template DNA, 1 µL of dNTPs, 2 µL of each primer, 0.1 µL of Taq DNA polymerase, and either 17.4 or 18.4 µL of nuclease-free water, resulting in a final reaction volume of 25 µL. With ethidium bromide staining, PCR products were separated using electrophoresis on a 2% agarose gel [Table 2].
| Primer | Primer sequence (5’-3’) | Amplicon size | Ta a(°C) |
|---|---|---|---|
| blaCTXM-F | CGATGTGCAGTACCAGTAA | 585 | 48.15°C |
| blaCTXM-R | TTAGTGACCAGAATCAGCGG | ||
| blaOXA-F | GCGTGGTTAAGGATGAACAC | 438 | 49.1°C |
| blaOXA-R | CATCAAGTTCAACCCAACCG | ||
| blaNDM-F | GGTTTGGCGATCTGGTTTT | 621 | 50.25°C |
| blaNDM-R | CGGAATGGCTCATCACGATC | ||
| blaKPC-F | CGTCTAGTTCTGCTGTCTTG | 798 | 48.15°C |
| blaKPC-R | CTTGTCATCCTTGTTAGGCG | ||
| blaSHV-F | CGCCATTACCATGAGCGATA | 86 | 50°C |
| blaSHV-R | CGCAAAAAGGCAGTCAATCC | ||
| blaTEM-F | AAGTTGCAGGACCACTTCTG | 202 | 50.15°C |
| blaTEM-R | GCACCTATCTCAGCGATCTG |
CTX-M: Cefotaximase-München, SHV: Sulfhydryl variable, TEM: Temoniera, KPC: Klebsiella pneumoniae carbapenemase, OXA: Oxacillinase, NDM: New Delhi metallo-β-lactamase
RESULTS
In total, 164 bacterial isolates were collected from HWW. The isolates comprised a diverse range of bacteria, including K. pneumoniae n = 102 (62%), E. coli n = 41 (25%), P. aeruginosa n = 17 (10%) and Enterococcus n = 4 (3%). The drain exhibited the highest level of contamination, indicating that both healthcare workers and patients who cleanse their hands in the basin contribute to the transfer of clinical bacteria into the drainage, which eventually flows into the sewage lines.
Antibiotic resistance pattern of hospital wastewater: The most resistant antibiotics were CXM, PIT, OF, NX, NIT, CPT, and COT which were 100, 99, 98, 97, 90, 87% resistant, respectively. Least resistance was found in PB, Amoxicillin- clavulanic acid (AMC), AK, C, and HLG, antibiotics which were 35, 47, 52, 56, 60% resistant, respectively [Table 3].
| S.No. | Antibiotic | Resistant (%) | Susceptibility (%) |
|---|---|---|---|
| 1 | Amikacin | 85 (52) | 79 (48) |
| 2 | Amoxyclav | 77 (47) | 87 (53) |
| 3 | Chloramphenicol | 92 (56) | 72 (44) |
| 4 | Colistin | 127 (77) | 37 (23) |
| 5 | Ceftazidime | 153 (93) | 11 (7) |
| 6 | Cefoperazone/Sulbactam | 154 (94) | 10 (6) |
| 7 | Ciprofloxacin | 116 (71) | 48 (29) |
| 8 | Cefepime/Tazobactam | 147 (90) | 17 (10) |
| 9 | Co-trimoxazole | 142 (87) | 22 (13) |
| 10 | Ceftriaxone | 135 (82) | 29 (18) |
| 11 | Cefotaxime | 123 (75) | 41 (25) |
| 12 | Cefuroxime | 164 (100) | 0 |
| 13 | Gentamicin | 99 (60) | 65 (40) |
| 14 | Imipenem/cilastatin | 153 (93) | 11 (7) |
| 15 | Minocycline | 141 (86) | 23 (14) |
| 16 | Meropenem | 151 (92) | 13 (8) |
| 17 | Nitrofurantoin | 159 (97) | 5 (3) |
| 18 | Norfloxacin | 160 (98 | 4 (2) |
| 19 | Ofloxacin | 162 (99) | 2 (1) |
| 20 | Polymyxin-B | 57 (35) | 107 (65) |
| 21 | Piperacillin/tazobactam | 163 (99) | 1 (1) |
Among the eight distinct classes of antibiotics evaluated, the highest resistance was noted for penicillins, while the lowest resistance was reported for the miscellaneous category, with C identified as the most potent in this group, as illustrated in Figure 1. Overall, AK emerged as the most effective antibiotic, demonstrating a resistance rate of 85 (52%) among 164 isolates.

The isolates exhibited a diverse occurrence of the 6 beta- lactam genes, with blaTEM being the most common at 34%, closely succeeded by blaCTX-M at 26%. The gene blaOXA was detected in 18% of the isolates, while blaSHV appeared in 13%. No presence of the blaKPC or blaNDM genes was observed [Table 4, Figures 2 and 3].
| Gene name/classification | Positive isolates, n/N (%) |
|---|---|
| Class A β-lactamase | |
| blaCTX−M | 10/38 (26) |
| blaSHV | 5/38 (13) |
| blaTEM | 13/38 (34) |
| blaKPC | 0/38 (0) |
| Class D β-lactamase | |
| blaOXA | 7/38 (18) |
| Carbapenemase group | |
| blaNDM | 0/38 (0) |
n: Number of positive isolates, N: Total isolates tested (38)


DISCUSSION
The setting of a hospital is a complex system that has often been ignored as a possible source of bacteria; however, with the increasing incidence of hospital-acquired infections, it has become an important focus for microbial research.[37] In addition, the rising patterns of antibiotic resistance in microbes have compelled the research community to explore the sources of such pathogens and the ways in which they acquire resistance in various environmental contexts. Bodies of water have also been identified as a source of antibiotic resistance, particularly because they promote interactions between pathogenic and non-pathogenic bacteria, contributing to the rise in resistance levels.[38]
In the present study, a total of 164 bacterial isolates were obtained from HWW. The collection comprised various bacteria, including K. pneumoniae (n = 102, 62%), followed by E. coli (n = 41, 25%), P. aeruginosa (n = 17, 10%), and Enterococcus (n = 4, 3%). A similar bacterial distribution was reported by Aleem et al.[39] who examined 162 isolates, with 127 classified as Gram-negative and 35 as Gram- positive. Their findings included a range of bacteria such as Klebsiella spp. (13%), Pseudomonas spp. (10%), E. coli (9%), and Enterococcus spp. Duran-Bedolla et al.[40] documented comparable outcomes, identifying 243 Gram- negative isolates across 21 distinct bacterial species. Among these, E. coli accounted for 32.9% (80/243) and Enterobacter spp. for 24.6% (60/243), representing a cumulative total of 71.9%. In a related study by Zhang et al.[41] it was noted that 62 out of 104 isolates (59.6%) were classified as Enterobacteriaceae, with E. coli making up 35 (56.5%), K. pneumoniae 17 (27.4%), Enterobacter spp. 5 (8.1%), and Pseudomonas spp. 6 (5.8%). Similar proportions were noted in further research that assessed the variety of bacteria found in hospital environments, highlighting the common occurrence of GNB.[42]
In terms of the resistance patterns found in HWW, the antibiotics exhibiting the highest resistance included CXM, PIT, OF, NX, NIT, CPT, and COT, with resistance rates of 100%, 99%, 98%, 97%, 90%, 87%, respectively. The antibiotics showing the least resistance were PB, Amoxiclav (AMC), AK, C, and HLG, which had resistance rates of 35%, 47%, 52%, 56%, and 60%, respectively. A study conducted by Duran- Bedolla et al.[40] found similar observations, reporting 100% resistance against CAZ, while cefepime, imipenem, and MRP also showed high resistance. The lower resistance was noted with AK and levofloxacin, which had resistance rates of 50% and 42%, respectively. Another related investigation by Aleem et al.[39] reported higher resistance levels, with 90% resistance to CIP, cefoxitin, and erythromycin, 80% resistance to CTR, and 40% resistance concerning carbapenems. These findings align with our research, which demonstrated 100% resistance to AMP and over 80% resistance to amoxicillin, aminoglycosides, and macrolides. A similar conclusion was highlighted by Endalamaw et al.[43] revealing that all K. pneumoniae and more than half of E. coli showed resistance to the third-generation cephalosporins like CAZ. Furthermore, in the wastewater from government hospitals in Addis Ababa, 43.3% of E. coli demonstrated resistance to CTR.[44] There is either a lack of understanding about how these medications should be used or inappropriate disposal practices for antimicrobials.[45] In addition, it may result from the release of sub-therapeutic levels of antibiotics from hospitals into the ecosystem, potentially exerting selective pressure on vulnerable bacteria in that setting. Consequently, it has been documented that wastewater from hospitals promotes the growth of antibiotic-resistant bacteria within healthcare settings.
Additionally, in this study, beta-lactam resistance genes were examined in wastewater samples collected from hospitals. It was revealed that during the study period, both ESBL and carbapenem resistance genes were present in these samples. The resistance patterns identified are primarily associated with the increased activity of beta-lactam in these strains, which is related to the beta-lactamase genes. The isolates we tested contained extended-spectrum beta-lactamase genes: blaTEM, blaCTXM, blaOXA, and blaSHV, with frequencies calculated at 34%, 26%, 18%, and 13%, respectively. No blaKPC or blaNDM genes were detected. In a different study conducted by Aleem et al., blaTEM was found to be the most common gene at 68%,[39] closely followed by blaSHV at 66%. The presence of blaCTX-M was recorded at 29%, with blaNDM at 18% and blaOXA at 16%. Similarly, no blaKPC gene was identified, aligning with our results. In another related investigation by Duran-Bedolla et al., the identified β-lactamases included blaTEM at 33.1%, blaCTX-M at 25.4%, blaKPC also at 25.4%, blaNDM at 8.8%, blaSHV at 5.3%, and blaOXA-48 at 1.1%.[39,40]
There is an increasing health concern associated with the identification of various multidrug-resistant opportunistic pathogens in WWTPs and in river environments, including E. coli, K. pneumoniae, Enterobacter species, and Acinetobacter species. It is crucial to increase efforts focused on improving the removal of microorganisms that are resistant to antimicrobials from wastewater in hospitals.
The methods used in wastewater treatment may affect the prevalence of genes associated with antibiotic resistance in samples of wastewater.[46] According to earlier research,[47-49] there is an increase in the number of ESBL-producing E. coli and K. pneumoniae in the community. According to these findings, E. coli and K. pneumoniae were found in wastewater samples from clinical settings.
A notable strength of the present study is that it provides region-specific data from Odisha, a geographical area for which published information on ESBL and carbapenemase genes in HWW is limited. The predominance of blaTEM and blaCTX-M and the absence of and blaNDM blaKPC among the analyzed isolates suggest a resistance gene distribution pattern that may differ from reports from other parts of India, highlighting the importance of local AMR surveillance.
A limitation of this study relates to antimicrobial susceptibility testing methodology. Although susceptibility testing was performed using the Kirby–Bauer disk diffusion method according to CLSI guidelines, certain antibiotics included in the testing panel may not be routinely recommended for interpretation in Enterococcus spp. Furthermore, susceptibility testing of PB by disk diffusion is not recommended because of the poor diffusion characteristics of polymyxins in agar media; broth microdilution is considered the preferred method. Therefore, the PB results should be interpreted with caution. In addition, the very high resistance rates observed for several antibiotics may reflect the substantial antimicrobial selective pressure present in HWW environments; however, confirmation through larger multicenter studies and complementary susceptibility testing methods would strengthen these findings.
CONCLUSIONS
This study demonstrates the widespread occurrence of multidrug-resistant bacterial species and ESBL-associated resistance genes in HWW from Odisha. Among the screened isolates, blaTEM was the most prevalent resistance gene, followed by blaCTX-M, blaOXA, and blaSHV. Notably, no blaNDM or blaKPC carbapenemase genes were detected in the analyzed isolates. These findings highlight HWW as a potential environmental reservoir for AMR and underscore the importance of continuous surveillance, effective wastewater treatment, antimicrobial stewardship, and infection-control measures to limit the dissemination of resistant bacteria and resistance genes into the environment.
This study found that bacterial identification was based on conventional morphological and biochemical methods. Although these methods are widely used for routine microbiological identification, they may provide lower taxonomic resolution than advanced techniques such as Matrix assisted laser Desorption/Ionization -Time of flight mass spectrometry (MALDI-TOF) or 16S rRNA gene sequencing. Due to resource limitations, these molecular identification approaches were not employed in the present study. Future investigations should incorporate advanced identification methods to improve species-level accuracy and strengthen the characterization of AMR determinants.
Author’s contributions:
AD, SK, BSD: Conceptualization; study design and methods development; data collection; data analysis and interpretation; writing original draft; critical revision and editing; final approval of the manuscript; LJ, KKS: Data acquisition, reviewing, final approval of the manuscript.
Ethical approval:
Institutional Review Board approval is not required for this study as it involved only hospital wastewater samples and did not involve human participants or patient-related data.
Declaration of patient consent:
Patient’s consent is not required as there are no patients in this study.
Conflicts of interest:
There are no conflicts of interest.
Use of artificial intelligence (AI)-assisted technology for manuscript preparation:
The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.
Financial support and sponsorship: Nil.
References
- A review of emerging micro-pollutants in hospital wastewater: Environmental fate and remediation options. Results Eng. 2022;16:100671.
- [CrossRef] [Google Scholar]
- Assessment of antibiotic-and disinfectant-resistant bacteria in hospital wastewater, south Ethiopia: A cross-sectional study. J Infect Dev Ctries. 2015;9:149-56.
- [CrossRef] [PubMed] [Google Scholar]
- Sources, occurrence, and environmental risk assessment of antibiotics and antimicrobial- resistant bacteria in aquatic environments of Poland In: Polish River Basins and Lakes-Part II: Biological Status and Water Management. Cham: Springer International Publishing; 2019. p. :179-93.
- [CrossRef] [Google Scholar]
- Antibiotics in hospital effluents and their impact on the antibiotics resistant bacteria and remediation of the antibiotics: A review. Netw Pharmacol. 2019;4:6-30.
- [Google Scholar]
- Occurrences and characterization of antibiotic-resistant bacteria and genetic determinants of hospital wastewater in a tropical country. Antimicrob Agents Chemother. 2016;60:7449-56.
- [CrossRef] [PubMed] [Google Scholar]
- Patients hospitalized abroad as importers of multiresistant bacteria-a cross-sectional study. Clin Microbiol Infect. 2017;23:673.e1-8.
- [CrossRef] [PubMed] [Google Scholar]
- The scourge of antibiotic resistance: The important role of the environment. Clin Infect Dis. 2013;57:704-10.
- [CrossRef] [PubMed] [Google Scholar]
- Taxonomic and functional distribution of bacterial communities in domestic and hospital wastewater system: Implications for public and environmental health. Antibiotics (Basel). 2021;10:1059.
- [CrossRef] [PubMed] [Google Scholar]
- National Antimicrobial Resistance Surveillance Systems and Participation in the Global Antimicrobial Resistance Surveillance System (GLASS): A Guide to Planning. 2016. Implementation, and Monitoring and Evaluation. Geneva: World Health Organization; Avaliable from: https://www.who.int/publications/i/item/WHO-DGO-AMR-2016.4 [Last accessed on 2026 Jan 30]
- [Google Scholar]
- Global Priority List of Antibiotic-Resistant Bacteria to Guide Research, Discovery, and Development Geneva: World Health Organization; 2017. p. :1-7.
- [Google Scholar]
- Antibiotic resistance in the environment. Nat Rev Microbiol. 2022;20:257-69.
- [CrossRef] [PubMed] [Google Scholar]
- Antibiotic pollution in the environment: From microbial ecology to public policy. Microorganisms. 2019;7:180.
- [CrossRef] [PubMed] [Google Scholar]
- Temporal variability of antibiotics fluxes in wastewater and contribution from hospitals. PLoS One. 2013;8:e53592.
- [CrossRef] [PubMed] [Google Scholar]
- Contribution of hospital effluents to the load of pharmaceuticals in urban wastewaters: Identification of ecologically relevant pharmaceuticals. Sci Total Environ. 2013;461:302-16.
- [CrossRef] [PubMed] [Google Scholar]
- Distribution of antibiotic resistance genes in the environment. Environ Pollut. 2021;285:117402.
- [CrossRef] [PubMed] [Google Scholar]
- The evolution of plasmid-carried antibiotic resistance. BMC Evol Biol. 2011;11:130.
- [CrossRef] [PubMed] [Google Scholar]
- Occurrence of antibiotics and antibiotic resistance genes in hospital and urban wastewaters and their impact on the receiving river. Water Res. 2015;69:234-42.
- [CrossRef] [PubMed] [Google Scholar]
- Global monitoring of antimicrobial resistance based on metagenomics analyses of Urban sewage. Nat Commun. 2019;10:1124.
- [CrossRef] [PubMed] [Google Scholar]
- Metagenomic analysis of an urban resistome before and after wastewater treatment. Sci Rep. 2020;10:8174.
- [CrossRef] [PubMed] [Google Scholar]
- Antibiotic-resistance genes in waste water. Trends Microbiol. 2018;26:220-8.
- [CrossRef] [PubMed] [Google Scholar]
- Human health risk assessment of antibiotic resistance associated with antibiotic residues in the environment: A review. Environ Res. 2019;169:483-93.
- [CrossRef] [PubMed] [Google Scholar]
- Global contributors to antibiotic resistance. J Glob Infect Dis. 2019;11:36-42.
- [CrossRef] [PubMed] [Google Scholar]
- Molecular mechanisms of antibiotic resistance. Nat Rev Microbiol. 2015;13:42-51.
- [CrossRef] [PubMed] [Google Scholar]
- Extended-spectrum beta-lactamase-producing Enterobacteriaceae: An emerging public-health concern. Lancet Infect Dis. 2008;8:159-66.
- [CrossRef] [PubMed] [Google Scholar]
- β-Lactamases: A focus on current challenges. Cold Spring Harb Perspect Med. 2017;7:a025239.
- [CrossRef] [PubMed] [Google Scholar]
- Carbapenem resistance: Overview of the problem and future perspectives. Ther Adv Infect Dis. 2016;3:15-21.
- [CrossRef] [PubMed] [Google Scholar]
- Past and present perspectives on β-lactamases. Antimicrob Agents Chemother. 2018;62:e01076-18.
- [CrossRef] [PubMed] [Google Scholar]
- Predictors of carbapenem-resistant Klebsiella pneumoniae acquisition among hospitalized adults and effect of acquisition on mortality. Antimicrob Agents Chemother. 2008;52:1028-33.
- [CrossRef] [PubMed] [Google Scholar]
- Association between carbapenem resistance and mortality among adult, hospitalized patients with serious infections due to Enterobacteriaceae: Results of a systematic literature review and meta-analysis. Open Forum Infect Dis. 2018;5:ofy150.
- [CrossRef] [PubMed] [Google Scholar]
- The rapid spread of carbapenem-resistant Enterobacteriaceae. Drug Resist Updat. 2016;29:30-46.
- [CrossRef] [PubMed] [Google Scholar]
- Carbapenem resistance in Enterobacteriaceae: Here is the storm! Trends Mol Med. 2012;18:263-72.
- [CrossRef] [PubMed] [Google Scholar]
- Urban riverine environment is a source of multidrug-resistant and ESBL-producing clinically important Acinetobacter spp. Environ Sci Pollut Res. 2016;23:3525-35.
- [CrossRef] [PubMed] [Google Scholar]
- Plasmids carrying antimicrobial resistance genes in Enterobacteriaceae. J Antimicrob Chemother. 2018;73:1121-37.
- [CrossRef] [PubMed] [Google Scholar]
- Bergey's Manual of Determinative Bacteriology United States: Lippincott Williams and Wilkins; 1994.
- [Google Scholar]
- Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol. 1966;45:493-6.
- [CrossRef] [PubMed] [Google Scholar]
- Performance Standards for Antimicrobial Susceptibility Testing United States: ResearchGate; 2008.
- [Google Scholar]
- Antibiotic resistance in major rivers in the world: A systematic review on occurrence, emergence, and management strategies. J Clean Prod. 2019;234:1484-505.
- [CrossRef] [Google Scholar]
- Moving from the traditional paradigm of pathogen inactivation to controlling antibiotic resistance in water-role of ultraviolet irradiation. Sci Total Environ. 2019;662:923-39.
- [CrossRef] [PubMed] [Google Scholar]
- Prevalence of bacteria and antimicrobial resistance genes in hospital water and surfaces. Cureus. 2021;13:e18738.
- [CrossRef] [Google Scholar]
- Citrobacter spp. and Enterobacter spp. as reservoirs of carbapenemase blaNDM and blaKPC resistance genes in hospital wastewater. Appl Environ Microbiol. 2024;90:e01165-24.
- [CrossRef] [PubMed] [Google Scholar]
- The prevalence and characterization of extended-spectrum β-lactamase-and carbapenemase-producing bacteria from hospital sewage, treated effluents and receiving rivers. Int J Environ Res Public Health. 2020;17:1183.
- [CrossRef] [PubMed] [Google Scholar]
- The role of the intensive care unit environment and health-care workers in the transmission of bacteria associated with hospital acquired infections. J Infect Public Health. 2016;9:13-23.
- [CrossRef] [PubMed] [Google Scholar]
- Antimicrobial resistance profile of bacteria from hospital wastewater at two specialized hospitals in Bahir Dar city, Ethiopia. BMC Microbiol. 2024;24:525.
- [CrossRef] [PubMed] [Google Scholar]
- Occurrence and anti-microbial susceptibility pattern of extended spectrum beta-lactamase producing Enterobacteriaceae in governmental hospitals wastewater in Addis Ababa, Ethiopia. Trop Med Health. 2022;50:57.
- [CrossRef] [PubMed] [Google Scholar]
- Knowledge and beliefs on antimicrobial resistance among physicians and nurses in hospitals in Amhara Region, Ethiopia. BMC Pharmacol Toxicol. 2014;15:26.
- [CrossRef] [PubMed] [Google Scholar]
- Hospital wastewater as a reservoir for antibiotic resistance genes: A meta-analysis. Front Public Health. 2020;8:574968.
- [CrossRef] [PubMed] [Google Scholar]
- Risk factors for acquisition of ESBL-producing Escherichia coli and Klebsiella pneumoniae on non-ventilator-associated hospital-acquired pneumonia in a tertiary care hospital in Indonesia. Malaysian J Microbiol. 2022;18:432-6.
- [CrossRef] [Google Scholar]
- Detection of carbapenem resistance genes and cephalosporin, and quinolone resistance genes along with oqxAB gene in Escherichia coli in hospital wastewater: A matter of concern. J Appl Microbiol. 2014;117:984-95.
- [CrossRef] [PubMed] [Google Scholar]
- Antibiotic resistance and antibiotic resistance genes in Escherichia coli isolates from hospital wastewater in Vietnam. Int J Environ Res Public Health. 2017;14:699.
- [CrossRef] [PubMed] [Google Scholar]

