Spectrum of Virulence Factors in Clinical Isolates of Staphylococcus aureus and Prevalence of SCCmec Types in Methicillin-Resistant Staphylococcus aureus in a Tertiary Care Center

Introduction

Methicillin-resistant Staphylococcus aureus (MRSA) is a public health concern on a global scale and a widely recognized multidrug-resistant bacteria.^[1] In many countries, 25 to 50% of all staphylococcal infections are attributable to MRSA.^[2] Though it is an essential component of the human microbiota, it is associated with a multitude of infections including skin and soft tissue, bacteremia, pneumonia, osteomyelitis, endocarditis, and toxin-mediated diseases.^[3]

Most MRSA possesses the mecA-encoded, low affinity, penicillin binding protein A movable genetic element found in the chromosome of MRSA called the staphylococcal cassette chromosome mec (SCCmec) and harbors the mecA and/or mecC genes, mediating methicillin resistance.^[4,5]

Staphylococcus aureus possesses virulence determinants genes that help the organism survive and colonize or interfere with the host defense system. They include various toxins like leucocidins, enterotoxins, exfoliative toxins, exotoxins, and hemolysis and surface components like capsules, peptidoglycans, teichoic acid, and protein A, in addition to enzymes like esterase, lipases, fatty acid modifying enzymes, proteases, hydrolytic enzymes, and catalases.^[1] Biofilm production is another crucial factor contributing to therapeutic resistance and pathogenicity. Multidrug resistance and the combination of the above pathogenic factors attribute to severity of infections.^[3] The surface proteins of Staphylococcus aureus aids in adhesion and colonization. The cellular proteins, proteases, and toxins prevent phagocytosis and blunt the immune response.^[6]

Enterotoxin genes, sea, seb, and sec, are associated with food poisoning. The serine protease enzyme such as exfoliative toxin encoded by the gene eta is related to blister development, cell- to-cell adhesion, and keratinocyte loss. The tst gene encodes for toxic shock syndrome toxin, an exoprotein and a member of the pyrogenic toxin super antigen family, and impairs the immunological response of the cells, ultimately causing cell death.^[6]

Staphylococcus aureus produces exotoxins^[7] that are cytolytic which form β-barrel pores in the plasma membrane, leading to leakage of the cell contents and lysis cytolysins include α-hemolysin, β-hemolysin, γ-hemolysin, leukocidin, and Panton-Valentine leukocidin (PVL).^[8] The hla gene codes for the α-hemolysin that is lethal to human epithelial cells and a primary agent in skin infections. The beta-hemolysin, encoded by the hlb gene, is a sphingomyelinase and is presumed to have a role in lung injury and pneumonia.^[9]

Panton Valentine leukocidin (pvl) is a synergohymenotropic toxin that also causes pores in cell membranes. Although sepsis and necrotizing pneumonia have been documented in association with pvl-producing MRSA, most often they cause minor skin or soft tissue infections. Pvl is primarily encountered in community-associated MRSA and infrequently in-hospital isolates; thus, it is regarded as a marker for community-acquired strains. It exhibits affinity towards leukocytes.^[7]

Staphylococcal scalded skin syndrome is linked to the, exfoliative toxins namely, ETA and ETB that are pyrogenic exoproteins. The exfoliative toxins, ETA and ETB, are encoded by the eta and etb genes, respectively. Despite sharing the same biological functions, ETA and ETB have different immunological traits. The eta gene is considered to occur in higher frequency.^[10]

The intercellular adhesion cluster, which contains the ica gene, aids in the formation of biofilm. The clumping factors, clfA and clfB, fibronectin-binding proteins A (FnBA) and B (FnBB), collagen binding protein, and staphylococcal protein A are typical members of microbial surface component recognizing adhesive matrix molecules and are critical for adherence.^[7] The fnbA and fnbB favor cell internalization and intercellular persistence leading to chronic infections.^[6] Clumping factor A (ClfA) is linked to the fibrinogen region causing bacterial or platelet aggregation in the blood.^[11]

Rich genetic diversity in the SCCmec element causes proliferation of virulence and antibiotic resistance determinants. Till date, 15 SCCmec types (I–XV) have been recognized, based on the combinations of five mec complexes (classes A, B, C1, C2, and E) and nine ccr gene complexes (types I–IX).^[12] The variety of SCCmec types and virulence factors creates a reservoir for transmission of infections.

This study was undertaken to investigate the common virulence genes in clinical isolates of Staphylococcus aureus, determine their antimicrobial susceptibility profile, and to characterize the SCCmec types among MRSA in a tertiary-care teaching hospital.

Materials and Methods

Phenotypic Methods

Molecular Methods

Polymerase Chain Reaction

All the isolates were subjected to molecular confirmation using the species specific nuc gene.^[16]MecA and mecC genes were amplified to detect methicillin resistance.^[17,18] Triplex, duplex, and simplex PCR were set up to detect the genes encoding virulence factors such as icaA (intracellular adhesin protein), hla and hlb (hemolysin toxin alpha and hemolysin toxin beta), pvl (Panton valentine toxin), sea, seb and sec (staphylococcal enterotoxin A, staphylococcal enterotoxin B, and staphylococcal enterotoxin c), eta (exfoliative toxin A), clfA (clumping factor), tst (toxic shock syndrome), fnbA and fnbB (fibronectin binding protein), with the following PCR conditions: Initial denaturation at 94°C for 5 minutes, denaturation at 94°C for 15 seconds, annealing: variable for 30 seconds, and extension at 72°C for 35 cycles for 30 seconds, Final extension at 72°C for 45 seconds. All the PCR reactions were carried out with a final volume of 25 µL reaction. Each reaction contained 10pmol of each primer (Eurofins, Bangalore, India) and 23 µL of master mix (Takara, India) and 2µL of template DNA.^[19–21]

Multiplex PCR was set up for SCCmec typing with the following PCR conditions: Initial denaturation at 94°C for 3 minutes, denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 35 cycles for 1 minute, final extension at 72°C for 7 minutes. PCR was performed in a mixture of 30 μL volume containing 15 μL master mix (Takara, India); 0.5 μL of each of βF1, α3R1, ccrCF, and ccrCR primers (10pmol/μL; Eurofins, India); 0.3μL of each of 1272F1, 1272R1, 5RmecAF, 5R431R primers (10pmol/μL; Eurofins, India; and 2μL template DNA. The final volume was adjusted to 30μL by adding 9.8μL sterile ultrapure water (Takara, India).^[22]

The amplicons were separated in a 2% agarose gel containing ethidium bromide (►Fig. 1). The primers used are described in ►Table 1. Previously, characterized strains were used as positive controls. Sterile Mili Q water was used as negative controls.

Close

Fig. 1

Image of gel electrophoresis of polymerase chain reaction for the detection of virulence genes of Staphylococcus aureus. DNA ladder (100bp) (L1 and L8), icaA, hla and hlb (L2), pvl and fnbA (L3), eta and seb (L4), sea and clfA (L5), sec and tst (L6), fnbB (L7).

Export to PPT

Table 1 Primers and PCR conditions used for resistance genes, virulence genes, and SCCmec typing of clinical isolates of Staphylococcus aureus

	Gene	Primer sequence	Temperature	Amplicon	Reference
Methicillin resistance	nuc	F- TCGCTTGCTATGATTGTGG R- GCCAATGTTCTACCATAGC	50	359	15
	mecA	F- GTAGAAATGACTGAACGTCCGATAA R- CCAATTCCACATTGTTTCGGTCTAA	55	310	16
	mecC	F- GAAAAAAAGGCTTAGAACGCCTC R- GAAGATCTTTTCCGTTTTCAGC	54	132	17
Virulence genes	icaA	F- TCAGACACTTGCTGGCGCAGTC R- TCACGATTCTCTCCCTCTCTGCCATT	56	936	18
	hlb	F- GTGCACTTACTGACAATAGTGC R- GTTGATGAGTAGCTACCTTCAGT		309	19
	hla	F- CTGATTACTATCCAAGAAATTCGATTG R- CTTTCCAGCCTACTTTTTTATCAGT		209
	eta	F- CGCTGCGGACATTCCAACATGG R- TACATGCCCGCCACTTGCTTGT	60	676
	seb	F- ATTCTATTAAGGACACTAAGTTAGGGA R- ATCCCGTTTCATAAGGCGAGT		404
	sea	F- GAAAAAAGTCTGAATTGCAGGGAACA R- CAAATAAATCGTAATTAACCGAAGGTTC	56	676
	clfA	F- ATTGGCGTGGCTTCAGTGCT R- CGTTTCTTCCGTAGTTGCATTTG		292
	sec	F- GTAAAGTTACAGGTGGCAAAACTTG R- CATATCATACCAAAAAGTATTGCCGT	57	297
	tst	F- TTCACTATTTGTAAAAGTGTCAGACCCACT R- TACTAATGAATTTTTTTATCGTAAGCCCTT		180
	fnbB	F- GTAACAGCTAATGGTCGAATTGATACT R- CAAGTTCGATAGGAGTACTATGTTC	58	524
	pvl	F- ATCATTAGGTAAAATGTCTGGACATGATCC R- GCATCAASTGTATTGGATAGCAAAAGC	58	433
	fnbA	F- GATACAAACCCAGGTGGTGG R- TGTGCTTGACCATGYTCTTC		191	20
SCCmec typing	β	F- ATTGCCTTGATAATAGCCYTCT R- TAAAGGCATCAATGCACAAACACT	55	937	21
	a3
	ccrC	F- CGTCTATTACAAGATGTTAAGGATAAT R- CCTTTATAGACTGGATTATTCAAAATAT		518
	ccrC
	1272	F- GCCACTCATAACATATGGAA R- CATCCGAGTGAAACCCAAA		415
	1272
	5RmecA	F- TATACCAAACCCGACAACTAC R- CGGCTACAGTGATAACATCC		359
	5R431

Abbreviations: PCR, polymerase chain reaction; SCCmec, staphylococcal cassette chromosome mec.

The obtained sequences were submitted in the GenBank database under the following accession numbers: ON500665, ON500666, ON500667, ON500668, ON500669, ON500670, ON500671, ON500672, OP125544, OP125545.

Results

Phenotypic Methods

Molecular Methods

Among the 133 isolates, the nuc gene was present in all the isolates, confirming the identification as Staphylococcus aureus.

Discussion

There has been an increase in mortality and morbidity due to Staphylococcus aureus infections, both in the community and in health care settings. The pathogenicity of Staphylococcus aureus is due to the presence of various virulence factors that undermine the immune system and promote their survival and persistence.

Of the 133 study isolates, 54 (40.6%) isolates were MRSA. The prevalence of MRSA in a recent multicentric study conducted in India ranged from 32% to 80%.^[23] According to the Antimicrobial Resistance Surveillance network (ICMR), the prevalence of MRSA in the Indian population ranged from 21% to 45%.^[24] A study conducted in North India over a period of 3 years reported that MRSA increased from 28% in 2017 to 35.1% in 2019 with overall prevalence being 33.7%.^[25] The prevalence of MRSA infection was 37.34% according to a recent meta-analysis report from South India.^[26] In Asia-Pacific region, MRSA accounts for up to 50% of Staphylococcus aureus bloodstream infections. In North Europe, South Europe, Australia, and the United States, prevalence of MRSA was less than 5%, 25% to 50%, 20% to 33%, and 53%, respectively.^[27]

In this study, virulence genes in both MRSA and MSSA were investigated. Presence of one or more virulence genes was observed in 81.3% (108/133) of the study isolates. In both staphylococcal biotypes, various combinations of virulence genes were present. According to few studies, some genes are known to occur more frequently in each of the biotypes.^[28] Twenty-five (18.7%) isolates did not harbor any of the genes that were looked for in this study.

The genes encoding for fnbA and fnbB were encountered in 37.5% and 15% isolates, respectively, in this study. fnbA was the most common that is in concordance with studies from China and Palestine.^[20,29] However, in both these reports, prevalence of fnbA was higher than this study with 78.2% and 62.5%, respectively. Occurrence of fnbB was 29% in both the above reports.

In the current investigation, 15% of the isolates carried the clfA gene. There is a marked variation in the detection of clfA gene in clinical isolates of Staphylococcus aureus. In China, a study reported that all their study isolates carried the clfA gene, while a study from Brazil did not detect the clfA gene in any isolate.^[3,20] In Indian study, 58.7% MRSA harbored the clfA gene.^[30]

Polysaccharide intercellular adhesin, which is required for biofilm development, is encoded for and controlled by the intercellular adhesion (icaADCB) operon. Among the ica genes, icaA has been shown to be crucial for Staphylococcus aureus for the development of biofilms. The N-acetylglucosaminyltransferase enzyme, which generates N-acetylglucosamine oligomers from UDP-N-acetylglucosamine, is encoded by the icaA gene. In this study, icaA was detected in 34.5% (46/133) isolates, of which majority were from exudative 82.6% (38/46) isolates followed by blood 10.8% (5/46). Biofilm production was observed by microtiter plate in 39.8% (53/133) of the study isolates. Of these biofilm producers, icaA was present in 19 isolates only. The remaining 34 biofilm producers lacked icaA, indicating the presence of other biofilm encoding genes namely, icaB, icaC, and icaD, that were not included in the study protocol. The detection of icaA gene in this study was lower when compared to a study from North India, wherein 52.3% harbored the icaA gene.^[31] Studies from Brazil, China, and Iran reported 100%, 89.9%, and 60.3% of icaA, respectively. Hence, icaA may not be the sole gene associated with biofilm formation.^[32,33]

The hla and hlb genes that encode for cytolytic toxins such as alpha hemolysin and beta hemolysin in Staphylococcus aureus were the most common virulence genes in this study. Majority of the isolates (91.7%, 122/133) in the present investigation carried at least one of the hemolysin encoding gene, hla and/or hlb. Eleven isolates did not harbor any of the hemolysins. Hlb was more common than hla with their occurrence being 61.6% and 39%, respectively. In Iran also hlb was the most common hemolysin observed, while in China hla was the most predominant.^[1,20]

In this study among the enterotoxin encoding genes, sea gene was the most common and was present in 21% of the isolates followed by seb and sec with occurrence of 14.2 and 7.5%, respectively. This result is in agreement with an investigation from Iran who reported 40.6%, 19.6% and 3% of the sea, seb, and sec.^[34] Three studies from China observed that, among the enterotoxin genes, seb occurred more frequently.^[2,8,20] In Brazil, the investigators were able to detect sea (3.23%) and seb (54.84%) genes, respectively, but failed to detect the sec gene.^[3]

In this study, the occurrence of eta and tst genes was 5.2 and 10.5%, respectively. Previous studies have found wide variation (0.2% to 94.4%) in the occurrence of the eta gene in Staphylococcus aureus.^{[8,10,20,34–36]} The prevalence of tst gene ranged between 5% and 34.6% in various published reports.^{[8,32,35,37–40]}

Pvl gene was detected in 6.7% (9/133) and all were from isolates recovered from wound exudates. The occurrence of pvl gene is low, when compared to that of countries in the West.^[41] Other investigators from other countries have found the prevalence of pvl gene to be ranging from 11.3% to 42.8%.^{[2,3,8,20,36,40,42]}

In this study, the adhesion (fnbA, fnbB, and clfA) and cytolysins (hlb and hla) genes occurred more frequently particularly among isolates from exudative specimens. This suggests that adherence and cytotoxicity are majorly operative in skin and skin and soft tissue infections by Staphylococcus aureus

In this study, there is no significant difference in the distribution of virulence genes among MRSA and MSSA. This is in consensus to a study from Brazil that investigated 13 virulence genes in Staphylococcus aureus and found that there was no association between the presence of the virulence genes and methicillin resistance.^[40] However, some studies have found significant variation. An investigator from Columbia inferred that the virulence genes were more diverse and frequent in MSSA than in MRSA (83 vs. 73%).^[43] On the contrary, in Nigeria, a study compared the distribution of eight virulence genes among MRSA and MSSA and found that there was a significant association between MRSA and the presence of two virulence genes, eta and icaA.^[28] Another study from Hungary found that, out of the 14 studied virulence genes, adhesins like cna, sea, ica, and hlb were significantly more in MRSA, whereas superantigens like tst, eta, and sec were significantly abundant in MSSA.^[44] The results of our study demonstrate that MSSA strains continue to be a significant cause of infection, indicating that MRSA has not completely replaced MSSA strains in clinical settings.

It has been frequently demonstrated that hospital-associated MRSA carried SCCmec types I, II, and III, while community-acquired MRSA belonged to types IV and V.^[22] This characteristic distribution of SCCmec types is becoming increasingly irrelevant as evidenced by the detection of different SCCmec types in hospital settings. According to many published reports both within India and other countries, the prevalence of different SCCmec types of MRSA strains varied considerably. In this study, of the 54 MRSA, 26 (48.1%) belonged to SCCmec type I followed by 12.9% (7/54) and 1.8% (1/54) to type IV and II, respectively. SCCmec type V was not found in any of the study isolates. One isolate was of dual type (type I and III). Presence of two SCCmec types in a single isolate has been described, in studies from Sikkim and Hyderabad (1.1–3.3%).^[45,46] Notably in Canada the majority of the isolates were of dual type (73.58%).^[47] A proportion of our isolates were nontypeable (n = 19/54, 35.2%). In previous reports from India, the frequency of nontypeable MRSA was only 4% to 7.6%. The recent report from Hyderabad also found that 33.3% of the MRSA were not typeable in their study and this was attributed to the presence of clones endemic to the region and have suggested that large-scale multicentric investigation from the South Asian region would be required to gain further insights.^[45] In this study, the antibiotic susceptibility profile also did not reveal any notable difference among the various SCCmec types investigated in this study (►Table 6).

In this study, all the MRSA belonging to SCCmec types I, II, and IV carried different combinations of virulence genes investigated. This is in concordance with reports from India, Nigeria, Hungary, and Korea, wherein the MRSA isolates belonging to the different SCCmec types carried one or more virulence genes.^{[6,28,44,48,49,50]} In our study, one isolate that belonged to both the type I and III did not carry any of the virulence determinants. This may have harbored other virulence genes not included in the study protocol. In this study, of the nine pvl gene carriers and five were MRSA. Among these five pvl positive MRSA, two each belonged to SCCmec type I and IV and one belonged to type II.

In this study, the mortality rate was 6.76% (9/133) among the patients with staphylococcal infection that include six MSSA and three MRSA. While eight isolates from these patients carried one or more virulence genes, one isolate did not carry any of the virulence gene investigated in the study. However, the mortality rate was lower than studies from United states and Cape Town which reported that the in-hospital mortality attributed to Staphylococcus aureus infection was 13% and 29%, respectively.^[51,52]

In this study, by univariate analysis, it was evident that none of the virulence genes had significant association with mortality. This was similar to the observation in a study from Hungary which reported that the number of virulence genes carried and the presence of specific virulence factors did not influence the outcome of infection even though they had a reported a high mortality rate of 35.3% among patients with staphylococcal infections.^[44]

The characterization of multiple virulence genes in clinical isolates and their correlation with clinical outcomes can be considered as the strength of this study. Such a type of study has not been undertaken in India and elsewhere. A case-controlled study with large number of clinical isolates can provide more insights into the association of virulence factors with morbidity and mortality.

Conclusions

The distribution of virulence genes is similar in both MRSA and MSSA. MRSA belongs to the SCCmec types I to IV. In view of the nontypeable MRSA encountered in the study, the other SCCmec types, VI to XV, have to be investigated. Though the prevalence of MRSA is 40.6%, the possession of multiple virulence factors and multidrug resistance profile makes MRSA a formidable pathogen in clinical settings.