Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Brief Report
Case Report
Case Report and Review
Case Series
Commentary
Editorial
How do I do it
How I do it?
Invited Editorial
Letter to Editor
Letter to the Editor
Letters to Editor
Letters to the Editor
Mini Review
Original Article
Original Articles
Others
Review Article
Short communication
Short Paper
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Brief Report
Case Report
Case Report and Review
Case Series
Commentary
Editorial
How do I do it
How I do it?
Invited Editorial
Letter to Editor
Letter to the Editor
Letters to Editor
Letters to the Editor
Mini Review
Original Article
Original Articles
Others
Review Article
Short communication
Short Paper
View/Download PDF

Translate this page into:

Original Article
11 (
4
); 305-311
doi:
10.4103/JLP.JLP_59_19

Co occurrence of two 16S rRNA methyltrasferases along with NDM and OXA 48 like carbapenamases on a single plasmid in Klebsiella pneumoniae

Department of Microbiology, Sri Ramachandra Institute for Higher Education and Research, Chennai, Tamil Nadu, India
Address for correspondence: Dr. K. V. L. Aishwarya, Department of Microbiology, Sri Ramachandra Institute for Higher Education and Research, Chennai - 600 116, Tamil Nadu, India. E-mail: mailaishmicro@gmail.com
Licence

This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.

Disclaimer:
This article was originally published by Wolters Kluwer - Medknow and was migrated to Scientific Scholar after the change of Publisher.

Abstract

Abstract:

BACKGROUND:

The carbapenemase-encoding genes, blaNDM- and blaOXA-48-like, confer resistance to all the known beta-lactams and are encountered along with other beta-lactamase-encoding genes and/or 16S ribosomal RNA (rRNA)-methylating genes. The co-occurrence of blaNDM and blaOXA-48-like on a single plasmid is a rare occurrence.

AIM AND OBJECTIVE:

The purpose of the study was to characterize the plasmids in Klebsiella pneumoniae isolates producing 16S rRNA methyltransferase along with blaNDM, blaOXA-48-like, and other resistance encoding genes.

MATERIALS AND METHODS:

One-hundred and seventeen K. pneumoniae clinical isolates which were resistant to aminoglycosides were collected. Polymerase chain reaction-based screening for 16S rRNA methyltransferase genes armA, rmtB, and rmtC; carbapenamase genes blaNDM, blaOXA-48-like, blaIMP, blaVIM, and blaKPC; and other resistance genes such as blaTEM, blaSHV, blaCTX-M, and qnr (A, B, and S) determinants acc (6’) Ib-cr was performed. Conjugation experiment was carried out for seven isolates that anchored blaNDM and blaOXA-48-like along with any one of the 16S rRNA methyltransferases. The plasmid-based replicon typing for different plasmid-incompatible (Inc) group was performed on the conjugatively transferable plasmids.

RESULTS:

Among the 16S rRNA methyltransferases, armA was more predominant. blaNDM and blaOXA-48-like were present in 56 (47.86%) and 22 (18.80%) isolates, respectively. Out of seven isolates which were conjugatively transferable, only four had blaNDM and blaOXA-48-like on the same plasmid and they belonged to Inc N and A/C replicon. Three isolates co-harbored 16S rRNA methyltransferases armA, rmtB, and rmtC, and out of the them, one isolate harbored two 16S rRNA methyltransferases armA and rmtB, on the single-plasmid replicon A/C.

CONCLUSION:

This is the first report revealing the coexistence of blaNDM and blaOXA-48-like co-harboring two 16S rRNA methylases on a single conjugative plasmid replicon belonging to incompatibility group A/C.

Keywords

16S ribosomal RNA methyltransferase
A/C replicon
blaNDM
blaOXA-48 like
co-harboring
Klebsiella pneumoniae

Introduction

Aminoglycosides are highly potent broad-spectrum antibiotics with desirable properties for treating life-threatening infections. The resistance mechanisms exhibited by bacteria against aminoglycoside are as follows: (1) acquired lipid modification that makes the cell wall impermeable; (2) aminoglycoside-modifying enzymes that modify the antibiotic at specific sites, making it inactive; and (3) active expulsion of the drug by efflux mechanism.

A novel mechanism of resistance to aminoglycoside was first discovered in 2003 in Pseudomonas and Enterobacteriaceae,[12] in which the aminoglycoside-binding site is modified enzymatically by 16S ribosomal RNA (rRNA) methyltransferase, commonly known as RMTases. The 16S methyltransferases which are intrinsically found in both Streptomyces spp. and Micromonospora spp. have now been identified in other bacteria as a result of the uptake of a plasmid containing the RMTase encoding gene.[3] Till date, 11 RMTases have been identified, of which armA, rmtB, and rmtC are more frequent among Enterobacteriaceae.[45]

Aminoglycosides are often used as adjunct drugs for treatment, in combination with other classes of antibiotics. The 16S methylases are frequently associated with extended-spectrum beta-lactamases (ESBL), carbapenemases, and plasmid-mediated quinolone-resistant (PMQR) genes.[35] In Enterobacteriaceae, 16S rRNA methyltransferases have been found to occur with blaNDM[6] and rarely with blaOXA-48-like.[78]

Enterobacteriaceae harboring all the above but with single 16S rRNA methyltransferases have been reported from India, Singapore, Turkey, Oman, Switzerland, and France.[91011] However, the co-occurrence of two 16S rRNA methyltransferases along with blaNDM, blaOXA-48-like, and other resistant determinants on a single-plasmid replicon has not been reported till date. The presence of these genes on plasmid enables their spread to other bacterial species by horizontal gene transfer. The emergence of such multidrug-resistant bacteria is a cause for concern globally.

Classification of plasmids into incompatible (Inc) groups is necessary because specific Inc groups have been associated with virulence and are of epidemiological importance.[5] The plasmid Inc grouping is based on the fact that two plasmids belonging to the same Inc group cannot proliferate in the same cell line. With this as basis, Carattoli et al. in 2005 designed a polymerase chain reaction (PCR)-based replicon typing, in which 18 sets of primers were used to recognize the coding sequence of repA genes, the cis-repeats of the origin of replication, and the counter transcript RNA interference.[12]

In this context, the aim of this study was to detect the co-occurrence of the most common 16S methylases armA, rmtB, and rmtC with ESBL-encoding genes (blaTEM, blaSHV, and blaCTX-M), carbapenemase-encoding genes (blaIMP, blaVIM, blaKPC, blaNDM, and blaOXA-like), and PMQR-encoding genes (qnr determinants and aac (6’)-Ib-cr).

Materials and Methods

Ethical approval

The study was approved by the institutional ethical committee (IEC-NI/15/APR/6/18).

Bacterial isolates

The study included 117, nonrepetitive, amikacin-resistant clinical isolates of Klebsiella pneumoniae, collected over a period of 6 months (June 2015–December 2015). The isolates were obtained from specimens such as urine (65), exudates (27), blood (14), and respiratory secretions (11). All the isolates were speciated based on conventional methods or VITEK-2 system (Vitek-2 GN-card; BioMerieux, Brussels, Belgium).

Antibiotic susceptibility testing and minimum inhibitory concentration

The disc diffusion technique and determination of minimum inhibitory concentration (MIC) were performed in accordance with the Clinical Laboratory Standard Institute, 2016.[13] The antibiotics tested were amikacin (30 μg), gentamicin (10 μg), tobramycin (10 μg), imipenem (10 μg), ciprofloxacin (5 μg), piperacillin/tazobactam (100 μg/10 μg), cefotaxime (30 μg), cefazolin (30 μg), and cefuroxime (30 μg) (Himedia laboratories, Mumbai, Maharashtra, India). The MIC for amikacin was determined by agar dilution method.

Template DNA preparation

A single bacterial colony was inoculated into Luria-Bertani broth (Himedia laboratories, Mumbai, Maharashtra, India) and incubated overnight at 37°C, and it was then centrifuged at 10,000 rpm for 10 min. The pellet was re-suspended in 250 μl of Millipore water, boiled at 100°C for 10 min, and cooled and centrifuged at 10,000 rpm for 10 min. The supernatant served as the template DNA.

Polymerase chain reaction

Four sets of multiplex PCRs were carried out using the previously described primers and conditions[141516171819] for all the study isolates. The multiplex primers used for different sets of genes, their annealing temperature, and the amplicon size are listed in Table 1.

Table 1 Primers used for performing polymerase chain reaction for amplifying resistant genes
Multiplex set gene Primer Annealing temperature (°C) Amplicon size (bp)
1 armA F-CCGAAATGACAGTTCCTATC
R-GAAAATGAGTGCCTTGGAGG
52 864
rmtB F-GCT TTC TGC GGG CGA TGT AA
R-ATG CAA TGC CGC GCT CGT AT
173
rmtC F-CGA AGA AGT AAC AGC CAA AG
R-ATC CCA ACA TCT CTC CCA CT
711
2 blaTEM F- TTTCGTGTCGCCCTTATTCC
R-ATCGTTGTCAGAAGTAAGTTGG
60 404
blaSHV F- CGCCTGTGTATTATCTCCCT
R- CGAGTAGTCCACCAGATCCT
294
blaCTX-M F- CGCTGTTGTTAGGAAGTGTG
R- GGCTGGGTGAAGTAAGTGAC
754
3 blaIMP F- GGAATAGAGTGGCTTAAYTC
R-TCGGTTTAAYAAAACAACCACC
55 232
blaVIM F-GATGGTGTTTGGTCGCATA
R- CGAATGCGCAGCACCAG
390
blaOXA-48-like F- GCGTGGTTAAGGATGAACAC
R- CATCAAGTTCAACCCAACCG
438
blaNDM F -GGTTTGGCGATCTGGTTTTC
R -CGGAATGGCTCATCACGATC
621
blaKPC F- CGTCTAGTTCTGCTGTCTTG
R- CTTGTCATCCTTGTTAGGCG
798
4 qnrA F- TCAGCAAGAGGATTTCTCA
R- GGCAGCACTATTACTCCCA
52 516
qnrB F- GATCGTGAAAGCCAGAAAGG
R- ACGATGCCTGGTAGTTGTCC
469
qnrS F- ACGACATTCGTCAACTGCAA
R- TAAATTGGCACCCTGTAGGC
417
Simplex acc (6’) Ib-cr F- TTGGAAGCGGGGACGGA
R- ACACGGCTGGACCATA
53 260

Each reaction volume contained 2 μl of the DNA template added to the master mix which includes 10 pmol of the forward and reverse primers (Sigma-Aldrich, Missouri, United States), 10 Mm dNTPs (Takara, Shiga, Japan), 5U taq polymerase (Takara, Shiga, Japan), and 10X buffer with MgCl2 (Takara, Shiga, Japan).

Amplification reactions were performed under the following conditions: initial denaturation at 95°C for 4 min, followed by 32 cycles of denaturation at 94°C for 30 s, annealing based on the primer employed for 30 s with an extension at 72°C for 50 s, and a final extension for one cycle at 72°C for 5 min. The PCR product was then run on a 1.5% agarose gel for detection of the amplified fragment. Strains previously confirmed by PCR were sequenced and used as positive controls.

Bacterial conjugation

Mating-out assays were performed at 37°C using Escherichia coli J53 as recipient, and the donors were the isolates which were positive for 16S methylases along with blaNDM, and blaOXA-48-like genes. The transconjugants were screened on MacConkey agar plate containing 100 μg of sodium azide (Himedia Laboratories, Mumbai, Maharashtra, India) along with 10 μg of cefoxitin[20] and 4 μg of amikacin[21](SRL Pvt. Ltd, Mumbai, Maharashtra, India) each. The transconjugants were subjected to PCR detection of the antibiotic-resistant genes to confirm the transfer from the donor to the recipients.

Plasmid-based replicon typing

Plasmid-Inc group for the transconjugants was determined by plasmid-based replicon typing (PBRT) performed as described by Carattoli et al.[12] The 18 Inc groups tested were HI1, HI2, I1-αγ, X, L/M, N, FIA, FIB, W, Y, P, FIC, A/C, T, FIIAs, F, K, and B/O.

PBRT was carried out in Applied Biosystems (Vetri 96-well thermal cycler, Pittsburgh, Pennsylvania) with five different multiplex-PCRs and three simplex-PCRs under the following conditions: all the amplifications were performed with the following amplification scheme: cycle of denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 60°C for all the Inc groups except that of F Inc group simplex which anneals at 52°C for 30 s with an extension at 72°C for 50 s, and a final extension for one cycle at 72°C for 5 min. The amplicon was then run on a 1.5% agarose gel for detection of the amplified fragment, and its corresponding Inc group was identified. The primers used for both multiplex- and simplex-PCRs performed are summarized in Table 2.

Table 2 Primers used for replicon typing
Multiplex set Replicon type Primer Annealing temperature (°C) Amplicon size (bp)
1 HI1 F- GGAGCGATGGATTACTTCAGTAC
R-TGCCGTTTCACCTCGTGAGTA
60 471
HI2 F- TTTCTCCTGAGTCACCTGTTAACAC
R- GGCTCACTACCGTTGTCATCCT
644
I1 F- CGAAAGCCGGACGGCAGAA
R-TCGTCGTTCCGCCAAGTTCGT
139
2 X F-AACCTTAGAGGCTATTTAAGTTGCTGAT
R-TGAGAGTCAATTTTTATCTCATGTTTTAGC
60 376
L/M F- GGATGAAAACTATCAGCATCTGAAG
R- CTGCAGGGGCGATTCTTTAGG
785
N F- GTCTAACGAGCTTACCGAAG
R-GTTTCAACTCTGCCAAGTTC
559
3 FIA F-CCATGCTGGTTCTAGAGAAGGTG
R -GTATATCCTTACTGGCTTCCGCAG
60 462
FIB F-GGAGTTCTGACACACGATTTTCTG
R-CTCCCGTCGCTTCAGGGCATT
308
W F-CCTAAGAACAACAAAGCCCCCG
R-GGTGCGCGGCATAGAACCGT
242
4 Y F-AATTCAAACAACACTGTGCAGCCTG
R-GCGAGAATGGACGATTACAAAACTTT
60 765
P F-CTATGGCCCTGCAAACGCGCCAGAAA
R-TCACGCGCCAGGGCGCAGCC
534
FIC F-GTGAACTGGCAGATGAGGAAGG
R-TTCTCCTCGTCGCCAAACTAGAT
262
5 A/C F-GAGAACCAAAGACAAAGACCTGGA
R-ACGACAAACCTGAATTGCCTCCTT
60 465
T F-TTGGCCTGTTTGTGCCTAAACCAT
R-CGTTGATTACACTTAGCTTTGGAC
750
FII S F-CTGTCGTAAGCTGATGGC
R-CTCTGCCACAAACTTCAGC
270
Simplex 1 FrepB F-TGATCGTTTAAGGAATTTTG
R-GAAGATCAGTCACACCATCC
52 270
Simplex 2 K/B F-GCGGTCCGGAAAGCCAGAAAA
R-TCTTTCACGAGCCCGCCAAA
60 160
Simplex 3 B/O F-GCGGTCCGGAAAGCCAGAAAA
R-TCTGCGTTCCGCCAAGTTCGA
60 159

Results

The study isolates exhibited resistance to all the antimicrobials tested by disc diffusion method.

A high degree of resistance to amikacin (MIC range of >512 μg/mL) was observed in all the study isolates.

PCR screening revealed that, of the 117 isolates, 79 (67.52%) harbored armA, 19 (16.23%) rmtB, and 16 carried (13.67%) rmtC. Of these, four isolates harbored more than one 16S rRNA methyltransferase. blaNDM and blaOXA-48-like were detected in 60 (51.28%) and 25 isolates (21.36%), respectively. The co-occurrence of blaNDM and blaOXA-48-like carbapenamase was observed in seven isolates, along with one of the 16S rRNA methyltransferases. Other carbapenemases such as blaIPM, blaVIM, and blaKPC were not encountered.

The other resistance-encoding genes detected were Qnr determinant (48), acc (6’) Ib-cr (72), blaTEM (4), and blaCTX-M (9). Sixty isolates co-harbored blaTEM, blaSHV, and blaCTX-M. The occurrence of these genes with blaNDM, blaOXA-48-like, and 16S rRNA methyltransferase is depicted in Table 3.

Table 3 Number of isolates associated with the most common 16S rRNA methyltransferases along with other resistant determinants
Genes armA positives (n=79) rmtB positives (n=19) rmtC positives (n=16) armA+rmtB positives (n=2) rmtB+rmtC positives (n=2) armA+rmtC/armA+rmtB+rmtC (n=0)
blaNDM (n=60) 36 12 12 - - -
blaOXA-48- like (n=25) 20 3 2 - - -
blaNDM+ blaOXA-48 (n=7) 3 1 1 2 - -
blaIMP/VIM/KPC (n=0) - - - - - -
blaTEM (n=4) 2 2 - - - -
blaSHV (n=0) - - - - - -
blaCTX-M (n=9) 3 2 4 - - -
blaTEM+blaSHV (n=18) 12 3 2 1 - -
blaSHV+blaCTX-M (n=7) 2 5 - - - -
blaTEM+blaCTX-M (n=7) 3 1 1 - 2 -
blaTEM+blaSHV+blaCTX-M (n=70) 45 5 9 1 - -
qnr determinants (n=48) 32 6 4 1 - -
aac (6’)-Ib-cr (n=71) 47 11 10 1 2 -

Conjugation experiment was carried out for all the 7 out of 117 K. pneumoniae strains (KP1, KP48, KP98, KP124, KP231, KP297, and KP302) that co-harbored both blaNDM and blaOXA-48-like carbapenamases, along with one of the 16S rRNA methyltransferases. The conjugation yield products, namely the single transconjugant, their plasmid replicon type, the resistance genes, and their associated resistant determinants, are tabulated [Table 4].

Table 4 Isolates that co-harbored blaNDM and blaOXA-48-like along with their resistant determinants and plasmid-incompatible groups
Isolate number Source Donor-resistant determinants Transconjugant-resistant determinants Plasmid-incompatible group
KP1 Exudates blaNDM, blaOXA-48-like, armA, blaTEM, blaSHV. blaCTX-M blaOXA-48-like, armA, blaTEM, blaCTX-M L/M
KP48 Respiratory blaNDM, blaOXA-48-like, rmtC blaNDM, blaOXA48-like, rmtC N
KP98 Urine blaNDM, blaOXA-48-like, armA, rmtB, blaTEM, blaSHV. blaCTX-M , aac (6’)-Ib-cr, qnrB blaNDM , armA, rmtB, blaCTX-M, aac (6’)-Ib-cr, qnrB A/C
KP124 Urine blaNDM, blaOXA-48-like, rmtB, blaSHV. blaCTX-M, qnrB, aac (6’)-Ib-cr blaNDM, blaOXA-48-like, blaCTX-M, N
KP231 Urine blaNDM, blaOXA-48-like, armA, rmtB, blaTEM, blaSHV. aac (6’)-Ib-cr blaNDM, blaOXA-48-like, rmtB, armA, blaTEM, aac (6’)-Ib-cr A/C
KP297 Blood blaNDM, blaOXA-48-like, armA, blaTEM, blaSHV. blaCTX-M blaOXA-48-like, armA, blaTEM, blaCTX-M N
KP302 Urine blaNDM, blaOXA-48-like, armA, blaCTX-M, qnrB, aac (6’)-Ib-cr blaNDM, blaOXA-48-like, armA, blaCTXM, qnrB, aac (6’)-Ib-cr A/C

Out of the seven isolates that were conjugatively transferable, only four isolates had blaNDM and blaOXA-48-like on the same plasmid, and they belonged to replicon-Inc N and A/C. Of them, two isolates harbored only a single plasmid. One K. pneumoniae harbored two 16S rRNA methyltransferases armA and rmtB.

Discussion

K. pneumoniae is a common enterobacterial pathogen causing healthcare-associated infections such as bacteremia, urinary tract infection, pneumonia, and meningitis. The rampant usage of antibiotics is modeling the bacteria to exhibit a phenomenal change in the drug susceptibility pattern with remarkable changes at their genetic level.[21]

All the 117 K. pneumoniae isolates exhibited high-level resistance to amikacin with an MIC >512 μg/mL. Such high levels of resistance are attributable to the use of S-adenyosyl-L-methionine as a co-substrate and methylation of the aminoglycoside-binding A-site of the 16S rRNA of the bacterial ribosome.[22]

The plasmid-mediated 16S rRNA methyltransferase usually exhibits a strong linkage with multidrug-resistant determinants.[23] Among the ESBLs, blaTEM, blaSHV, and blaCTX-M were the most frequently encountered [Table 3]. Similar to our observation, the coexistence of these in Enterobacteriaceae has been reported from India previously.[242526]

In this study, the prevalence of armA (67.52%) was high when compared to that of rmtB (16.23%) and rmtC (13.67%). The greater occurrence of armA is presumably due to its co-existence with blaCTX-M on the same plasmid and its location on an effective transposon Tn1548.[27]

The presence of more than one 16S rRNA methyltransferase is seldom reported. Interestingly, we found four isolates (3.41%) harboring multiple 16S rRNA methyltransferases in combinations of armA + rmtB and rmtB + rmtC. The occurrence of more than one 16S rRNA methylases in our study was low as compared to a report from Northeast India[5] where it was observed in 27.64% of E. coli.

In a report from Morocco,[28] only 2 out of 116 aminoglycoside-resistant K. pneumoniae harbored both blaNDM and aac (6’)-Ib-cr. In this study, a higher proportion (46/117) co-harbored the above determinants, which is a cause for worry because it restricts the application of combination therapy.

Most of the blaNDM-harboring plasmids are usually untypeable,[29] whereas blaOXA-48-like plasmids are associated with IncL/M. The blaNDM producers can co-harbor other beta-lactamases and/or 16SrRNA methyltransferase genes (armA, rmtB, and rmtC). However, the co-occurrence of blaNDM and blaOXA-48-like in a single plasmid is rarely reported.[30]

In the present study, seven isolates harboring blaNDM and blaOXA-48-like along with 16S rRNA methyltransferase were conjugatively transferable. The incompatibility typing of plasmids revealed that armA was encoded within L/M-, A/C-, and N-Inc groups, whereas, rmtB and rmtC were encoded within A/C- and N-Inc groups, respectively. Two isolates which anchored both armA and rmtB were encoded within a single Inc group A/C. This pattern is in accordance with the report from North India[5] where multiple 16S methyltransferase genes were found on diverse Inc group types such as FIB, FIIS, I, T, X, N, Y, L/M, and FIA. By PBRT, the blaNDM and blaOXA48-like were encoded within plasmids belonging to L/M-, A/C-, and N-Inc groups. Previously, Soundari et al. have reported the presence of both blaNDM and blaOXA48-like in IncHI3 replicon.[29]

Conclusion

Our findings underline the emerging threat of multidrug-resistant pathogens that produce 16S rRNA methylase disseminating in this region.

This study is of epidemiological importance. There is co-occurrence of two 16SrRNA methyltransferases along with blaNDM and blaOXA48-like on single-plasmid replicon, and they belong to Inc A/C. To the best of our knowledge, this is the first report of such an occurrence till date. However, multi- centric studies needs to be carried out with increased sample size to have a better understanding about the different plasmid Inc types involved, their diverse source of origin and acquisition which would aid in the control strategies.

Financial support and sponsorship

This study was supported by the Department of Science and Technology under INSPIRE-fellowship scheme (reference number IF150368).

Conflicts of interest

There are no conflicts of interest.

References

  1. , , , , , , . Acquisition of 16S rRNA methylase gene in Pseudomonas aeruginosa. Lancet. 2003;362:1888-93.
    [Google Scholar]
  2. , , , . Plasmid-mediated high-level resistance to aminoglycosides in Enterobacteriaceae due to 16S rRNA methylation. Antimicrob Agents Chemother. 2003;47:2565-71.
    [Google Scholar]
  3. , , , , , , . RmtC and rmtF 16S rRNA methyltransferase in NDM-1-producing Pseudomonas aeruginosa. Emerg Infect Dis. 2015;21:2059-62.
    [Google Scholar]
  4. , , , , , , . Occurrence of armA and rmtB aminoglycoside resistance 16S rRNA methylases in extended-spectrum β-lactamases producing Escherichia coli in Algerian hospitals. Front Microbiol. 2016;7:1409.
    [Google Scholar]
  5. , , , , , , . Occurrence of acquired 16S rRNA methyltransferase-mediated aminoglycoside resistance in clinical isolates of Enterobacteriaceae within a tertiary referral hospital of Northeast India. Antimicrob Agents Chemother. 2017;61:e01037-16.
    [Google Scholar]
  6. , , , . Updated multiplex polymerase chain reaction for detection of 16S rRNA methylases: High prevalence among NDM-1 producers. Diagn Microbiol Infect Dis. 2011;71:442-5.
    [Google Scholar]
  7. , , , , . Characterization of Acinetobacter baumannii clinical isolates carrying bla (OXA-23) carbapenemase and 16S rRNA methylase ArmA genes in Yemen. Microb Drug Resist. 2014;20:604-9.
    [Google Scholar]
  8. , , , , , , . Emergence of OXA-carbapenemase – And 16S rRNA methylase-producing international clones of Acinetobacter baumannii in Norway. J Med Microbiol. 2011;60:515-21.
    [Google Scholar]
  9. , , , , , , . Emergence of Klebsiella pneumoniae co-producing NDM-type and OXA-181 carbapenemases. Clin Microbiol Infect. 2013;19:E421-3.
    [Google Scholar]
  10. , , , , , , . NDM-1 and rmtC-producing Klebsiella pneumoniae isolates in Turkey. Jundishapur J Microbiol. 2016;9:e33990.
    [Google Scholar]
  11. , , , , . Genetic features of blaNDM-1-positive Enterobacteriaceae. Antimicrob Agents Chemother. 2011;55:5403-7.
    [Google Scholar]
  12. , , , , , , . Identification of plasmids by PCR-based replicon typing. J Microbiol Methods. 2005;63:219-28.
    [Google Scholar]
  13. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing. CLSI Supplement M100S. CLSI Supplement M100S. Wayne, PA: Clinical and Laboratory Standards Institute; .
    [Google Scholar]
  14. , , , , , , . Plasmid-mediated 16S rRNA methylases conferring high-level aminoglycoside resistance in Escherichia coli and Klebsiella pneumoniae isolates from two Taiwanese hospitals. J Antimicrob Chemother. 2004;54:1007-12.
    [Google Scholar]
  15. , , . 16S ribosomal RNA methylation: Emerging resistance mechanism against aminoglycosides. Clin Infect Dis. 2007;45:88-94.
    [Google Scholar]
  16. , , , . Global spread of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis. 2011;17:1791-8.
    [Google Scholar]
  17. , , , , , , . Detection of extended spectrum beta-lactamases-producing isolates and effect of AmpC overlapping. J Infect Dev Ctries. 2013;7:618-29.
    [Google Scholar]
  18. , , , , , . Qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob Agents Chemother. 2006;50:2872-4.
    [Google Scholar]
  19. , , , , . Allele-specific polymerase chain reaction (PCR) for rapid detection of the aac (6’)-Ib-cr quinolone resistance gene. Int J Antimicrob Agents. 2010;36:476-7.
    [Google Scholar]
  20. , , , . Plasmid-mediated transfer of the bla (NDM-1) gene in gram-negative rods. FEMS Microbiol Lett. 2011;324:111-6.
    [Google Scholar]
  21. , , , , , , . Antimicrobial resistance among clinical isolates from the Chinese meropenem surveillance study (CMSS), 2003-2008. Int J Antimicrob Agents. 2010;35:227-34.
    [Google Scholar]
  22. , , . Exogenously acquired 16S rRNA methylases found in aminoglycoside- resistant pathogenic gram negative bacteria: An update. Drug Resist Updat. 2012;15:133-48.
    [Google Scholar]
  23. , , , , , , . Diverse prevalence of 16S rRNA methylase genes armA and rmtB amongst clinical multidrug-resistant Escherichia coli and Klebsiella pneumoniae isolates. Int J Antimicrob Agents. 2011;38:348-51.
    [Google Scholar]
  24. , , , , . Correlation of TEM, SHV and CTX-M extended-spectrum beta lactamases among Enterobacteriaceae with theirin vitro antimicrobial susceptibility. Indian J Med Microbiol. 2011;29:161-4.
    [Google Scholar]
  25. , , , , , , . Extended spectrum beta-lactamases in Escherichia coli and Klebsiella pneumoniae and associated risk factors. Indian J Med Res. 2009;129:695-700.
    [Google Scholar]
  26. , , , , , , . Carbapenem resistant Klebsiella pneumoniae isolated from bloodstream infection: Indian experience. Pathog Glob Health. 2017;111:240-6.
    [Google Scholar]
  27. , , , , . Worldwide disseminated armA aminoglycoside resistance methylase gene is borne by composite transposon Tn1548. Antimicrob Agents Chemother. 2005;49:2949-53.
    [Google Scholar]
  28. , , , , , , . Occurrence of OXA-48 and NDM-1 carbapenemase-producing Klebsiella pneumoniae in a Moroccan University hospital in Casablanca, Morocco. Infect Genet Evol. 2015;31:142-8.
    [Google Scholar]
  29. , , , . Abstracts of the 27th European Congress of Clinical Microbiology and Infectious Diseases. .
    [Google Scholar]
  30. , , , , , . Emergence of metallo-β-lactamase NDM-1-producing multidrug-resistant Escherichia coli in Australia. Antimicrob Agents Chemother. 2010;54:4914-6.
    [Google Scholar]
Show Sections